Mesodinium nuclear code
{{Short description|An alternative genetic code found in the nuclear genome of some ciliates}}
{{notability|date=November 2017}}
{{DISPLAYTITLE:Mesodinium nuclear code}}
The Mesodinium nuclear code (translation table 29) is a genetic code used by the nuclear genome of the ciliates Mesodinium and Myrionecta.{{Cite journal|last=Heaphy|first=Stephen M.|last2=Mariotti|first2=Marco|last3=Gladyshev|first3=Vadim N.|last4=Atkins|first4=John F.|last5=Baranov|first5=Pavel V.|date=2016-11-01|title=Novel Ciliate Genetic Code Variants Including the Reassignment of All Three Stop Codons to Sense Codons in Condylostoma magnum|journal=Molecular Biology and Evolution|language=en|volume=33|issue=11|pages=2885–2889|doi=10.1093/molbev/msw166|issn=0737-4038|pmc=5062323|pmid=27501944}}
The code (29)
: AAs = FFLLSSSSYYYYCC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
:Starts = --------------*--------------------M----------------------------
: Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
: Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
: Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
| class="wikitable" style="border: none; text-align: center;"
|+ | ||||
| DNA codons | RNA codons | This code (29) | style="border: none; width: 1px;" | | Standard code (1) |
|---|---|---|---|---|
TAA | UAA | style="background-color:#b3dec0;" | Tyr (Y) | style="border: none; width: 1px;" | | style="background-color:#B0B0B0;" | Ter (*) |
TAG | UAG | style="background-color:#b3dec0;" | Tyr (Y) | style="border: none; width: 1px;" | | style="background-color:#B0B0B0;" | Ter (*) |
==See also==
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
{{reflist}}