Blastocrithidia nuclear code

{{Short description|An alternative genetic code found in the nuclear genome of some flagellates}}

The Blastocrithidia nuclear code (translation table 31) is a genetic code used by the nuclear genome of the trypanosomatid genus Blastocrithidia.{{Cite journal |last1=Záhonová |first1=Kristína |last2=Kostygov |first2=Alexei Y. |last3=Ševčíková |first3=Tereza |last4=Yurchenko |first4=Vyacheslav |last5=Eliáš |first5=Marek |title=An Unprecedented Non-canonical Nuclear Genetic Code with All Three Termination Codons Reassigned as Sense Codons |journal=Current Biology |volume=26 |issue=17 |pages=2364–2369 |doi=10.1016/j.cub.2016.06.064 |pmid=27593378 |year=2016 |doi-access=free |bibcode=2016CBio...26.2364Z }} This code, along with translation tables 27 and 28, is remarkable in that every one of the 64 possible codons can be a sense codon.

The code (31)

: AAs = FFLLSSSSYYEECCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

:Starts = ----------**-----------------------M----------------------------

: Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

: Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

: Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).

Differences from the standard code

class="wikitable" style="border: none; text-align: center;"

class="wikitable" style="border: none; text-align: center;"
DNA codons ! RNA codons ! colspan="3" \| This code (31) ! style="border: none; width: 1px;" \| ! Standard code (1)
`TAA` \| `UAA` \| style="background-color:#B0B0B0;" \| `Ter` `()` \| or \| style="background-color:#f8b7d3;" \| `Glu` `(E)` \| style="border: none; width: 1px;" \| \| style="background-color:#B0B0B0;" \| `Ter` `()`
`TAG` \| `UAG` \| style="background-color:#B0B0B0;" \| `Ter` `()` \| or \| style="background-color:#f8b7d3;" \| `Glu` `(E)` \| style="border: none; width: 1px;" \| \| style="background-color:#B0B0B0;" \| `Ter` `()`
`TGA` \| `UGA` \| colspan="3" style="background-color:#ffe75f;" \| `Trp` `(W)` \| style="border: none; width: 1px;" \| \| style="background-color:#B0B0B0;" \| `Ter` `(*)`

DNA codons

! RNA codons

! colspan="3" | This code (31)

! style="border: none; width: 1px;" |

! Standard code (1)

TAA

| UAA