toxin-antitoxin system

{{Short description|Biological process}}

File:Toxin-antitoxin inheritance.png of a toxin-antitoxin system. (B) Horizontal gene transfer of a toxin-antitoxin system. PSK stands for post-segregational killing and TA represents a locus encoding a toxin and an antitoxin.{{cite journal | vauthors = Van Melderen L, Saavedra De Bast M | title = Bacterial toxin-antitoxin systems: more than selfish entities? | journal = PLOS Genetics | volume = 5 | issue = 3 | pages = e1000437 | date = March 2009 | pmid = 19325885 | pmc = 2654758 | doi = 10.1371/journal.pgen.1000437 | veditors = Rosenberg SM | doi-access = free }}]]

A toxin-antitoxin system consists of a "toxin" and a corresponding "antitoxin", usually encoded by closely linked genes. The toxin is usually a protein while the antitoxin can be a protein or an RNA. Toxin-antitoxin systems are widely distributed in prokaryotes, and organisms often have them in multiple copies.{{cite journal | vauthors = Fozo EM, Makarova KS, Shabalina SA, Yutin N, Koonin EV, Storz G | title = Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families | journal = Nucleic Acids Research | volume = 38 | issue = 11 | pages = 3743–59 | date = June 2010 | pmid = 20156992 | pmc = 2887945 | doi = 10.1093/nar/gkq054 }}{{cite journal | vauthors = Gerdes K, Wagner EG | title = RNA antitoxins | journal = Current Opinion in Microbiology | volume = 10 | issue = 2 | pages = 117–24 | date = April 2007 | pmid = 17376733 | doi = 10.1016/j.mib.2007.03.003 }} When these systems are contained on plasmids – transferable genetic elements – they ensure that only the daughter cells that inherit the plasmid survive after cell division. If the plasmid is absent in a daughter cell, the unstable antitoxin is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing' (PSK).{{cite journal | vauthors = Gerdes K | title = Toxin-antitoxin modules may regulate synthesis of macromolecules during nutritional stress | journal = Journal of Bacteriology | volume = 182 | issue = 3 | pages = 561–72 | date = February 2000 | pmid = 10633087 | pmc = 94316 | doi = 10.1128/JB.182.3.561-572.2000 }}{{cite journal | vauthors = Faridani OR, Nikravesh A, Pandey DP, Gerdes K, Good L | title = Competitive inhibition of natural antisense Sok-RNA interactions activates Hok-mediated cell killing in Escherichia coli | journal = Nucleic Acids Research | volume = 34 | issue = 20 | pages = 5915–22 | year = 2006 | pmid = 17065468 | pmc = 1635323 | doi = 10.1093/nar/gkl750}}

Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the translation of messenger RNA (mRNA) that encodes the toxin is inhibited by the binding of a small non-coding RNA antitoxin that binds the toxin mRNA. The toxic protein in a type II system is inhibited post-translationally by the binding of an antitoxin protein. Type III toxin-antitoxin systems consist of a small RNA that binds directly to the toxin protein and inhibits its activity.{{cite journal | vauthors = Labrie SJ, Samson JE, Moineau S | title = Bacteriophage resistance mechanisms | journal = Nature Reviews. Microbiology | volume = 8 | issue = 5 | pages = 317–27 | date = May 2010 | pmid = 20348932 | doi = 10.1038/nrmicro2315 | s2cid = 205497795 }} There are also types IV, V and VI, which are less common.{{cite journal | vauthors = Page R, Peti W | title = Toxin-antitoxin systems in bacterial growth arrest and persistence | journal = Nature Chemical Biology | volume = 12 | issue = 4 | pages = 208–14 | date = April 2016 | pmid = 26991085 | doi = 10.1038/nchembio.2044 }} Toxin-antitoxin genes are often inherited through horizontal gene transfer{{cite journal | vauthors = Mine N, Guglielmini J, Wilbaux M, Van Melderen L | title = The decay of the chromosomally encoded ccdO157 toxin-antitoxin system in the Escherichia coli species | journal = Genetics | volume = 181 | issue = 4 | pages = 1557–66 | date = April 2009 | pmid = 19189956 | pmc = 2666520 | doi = 10.1534/genetics.108.095190 }}{{cite journal | vauthors = Ramisetty BC, Santhosh RS | title = Horizontal gene transfer of chromosomal Type II toxin-antitoxin systems of Escherichia coli | journal = FEMS Microbiology Letters | volume = 363 | issue = 3 | pages = fnv238 | date = February 2016 | pmid = 26667220 | doi = 10.1093/femsle/fnv238 | doi-access = free }} and are associated with pathogenic bacteria, having been found on plasmids conferring antibiotic resistance and virulence.

Chromosomal toxin-antitoxin systems also exist, some of which are thought to perform cell functions such as responding to stresses, causing cell cycle arrest and bringing about programmed cell death.{{cite journal | vauthors = Hayes F | title = Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest | journal = Science | volume = 301 | issue = 5639 | pages = 1496–9 | date = September 2003 | pmid = 12970556 | doi = 10.1126/science.1088157 | bibcode = 2003Sci...301.1496H | s2cid = 10028255 }} In evolutionary terms, toxin-antitoxin systems can be considered selfish DNA in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large deletions of the host genome.{{cite journal | vauthors = Rowe-Magnus DA, Guerout AM, Biskri L, Bouige P, Mazel D | title = Comparative analysis of superintegrons: engineering extensive genetic diversity in the Vibrionaceae | journal = Genome Research | volume = 13 | issue = 3 | pages = 428–42 | date = March 2003 | pmid = 12618374 | pmc = 430272 | doi = 10.1101/gr.617103 }} Toxin-antitoxin systems have several biotechnological applications, such as maintaining plasmids in cell lines, targets for antibiotics, and as positive selection vectors.{{cite journal | vauthors = Stieber D, Gabant P, Szpirer C | title = The art of selective killing: plasmid toxin/antitoxin systems and their technological applications | journal = BioTechniques | volume = 45 | issue = 3 | pages = 344–6 | date = September 2008 | pmid = 18778262 | doi = 10.2144/000112955 | doi-access = free }}

Biological functions

= Stabilization and fitness of mobile DNA =

As stated above, toxin-antitoxin systems are well characterized as plasmid addiction modules. It was also proposed that toxin-antitoxin systems have evolved as plasmid exclusion modules. A cell that carries two plasmids from the same incompatibility group will eventually generate two daughter cells carrying either plasmid. Should one of these plasmids encode for a TA system, its "displacement" by another TA-free plasmid system will prevent its inheritance and thus induce post-segregational killing.{{cite journal | vauthors = Cooper TF, Heinemann JA | title = Postsegregational killing does not increase plasmid stability but acts to mediate the exclusion of competing plasmids | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 97 | issue = 23 | pages = 12643–8 | date = November 2000 | pmid = 11058151 | pmc = 18817 | doi = 10.1073/pnas.220077897 | bibcode = 2000PNAS...9712643C | doi-access = free }} This theory was corroborated through computer modelling.{{cite journal | vauthors = Mochizuki A, Yahara K, Kobayashi I, Iwasa Y | title = Genetic addiction: selfish gene's strategy for symbiosis in the genome | journal = Genetics | volume = 172 | issue = 2 | pages = 1309–23 | date = February 2006 | pmid = 16299387 | pmc = 1456228 | doi = 10.1534/genetics.105.042895 }} Toxin-antitoxin systems can also be found on other mobile genetic elements such as conjugative transposons and temperate bacteriophages and could be implicated in the maintenance and competition of these elements.{{cite journal|vauthors=Magnuson RD|date=September 2007|title=Hypothetical functions of toxin-antitoxin systems|journal=Journal of Bacteriology|volume=189|issue=17|pages=6089–92|doi=10.1128/JB.00958-07|pmc=1951896|pmid=17616596}}

= Genome stabilization =

File:S meliloti strain 1021 TA map.png of Sinorhizobium meliloti, with its 25 chromosomal toxin-antitoxin systems. Orange-labelled loci are confirmed TA systems{{cite journal | vauthors = Pandey DP, Gerdes K | title = Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes | journal = Nucleic Acids Research | volume = 33 | issue = 3 | pages = 966–76 | year = 2005 | pmid = 15718296 | pmc = 549392 | doi = 10.1093/nar/gki201 }} and green labels show putative systems.]]

Toxin-antitoxin systems could prevent harmful large deletions in a bacterial genome, though arguably deletions of large coding regions are fatal to a daughter cell regardless. In Vibrio cholerae, multiple type II toxin-antitoxin systems located in a super-integron were shown to prevent the loss of gene cassettes.{{cite journal | vauthors = Szekeres S, Dauti M, Wilde C, Mazel D, Rowe-Magnus DA | title = Chromosomal toxin-antitoxin loci can diminish large-scale genome reductions in the absence of selection | journal = Molecular Microbiology | volume = 63 | issue = 6 | pages = 1588–605 | date = March 2007 | pmid = 17367382 | doi = 10.1111/j.1365-2958.2007.05613.x | s2cid = 28191383 }}

= Altruistic cell death =

mazEF, a toxin-antitoxin locus found in E. coli and other bacteria, was proposed to induce programmed cell death in response to starvation, specifically a lack of amino acids.{{cite journal | vauthors = Aizenman E, Engelberg-Kulka H, Glaser G | title = An Escherichia coli chromosomal "addiction module" regulated by guanosine [corrected] 3',5'-bispyrophosphate: a model for programmed bacterial cell death | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 93 | issue = 12 | pages = 6059–63 | date = June 1996 | pmid = 8650219 | pmc = 39188 | doi = 10.1073/pnas.93.12.6059 | bibcode = 1996PNAS...93.6059A | doi-access = free }} This would release the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the inclusive fitness of the cell that perished. This would be an example of altruism and how bacterial colonies could resemble multicellular organisms. However, the "mazEF-mediated PCD" has largely been refuted by several studies.{{cite journal | vauthors = Ramisetty BC, Natarajan B, Santhosh RS | title = mazEF-mediated programmed cell death in bacteria: "what is this?" | journal = Critical Reviews in Microbiology | volume = 41 | issue = 1 | pages = 89–100 | date = February 2015 | pmid = 23799870 | doi = 10.3109/1040841X.2013.804030 | s2cid = 34286252 }}{{cite journal | vauthors = Tsilibaris V, Maenhaut-Michel G, Mine N, Van Melderen L | title = What is the benefit to Escherichia coli of having multiple toxin-antitoxin systems in its genome? | journal = Journal of Bacteriology | volume = 189 | issue = 17 | pages = 6101–8 | date = September 2007 | pmid = 17513477 | pmc = 1951899 | doi = 10.1128/JB.00527-07 }}{{cite journal | vauthors = Ramisetty BC, Raj S, Ghosh D | title = Escherichia coli MazEF toxin-antitoxin system does not mediate programmed cell death | journal = Journal of Basic Microbiology | volume = 56 | issue = 12 | pages = 1398–1402 | date = December 2016 | pmid = 27259116 | doi = 10.1002/jobm.201600247 | s2cid = 1685755 }}

= Stress tolerance =

Another theory states that chromosomal toxin-antitoxin systems are designed to be bacteriostatic rather than bactericidal. RelE, for example, is a global inhibitor of translation, is induced during nutrient stress. By shutting down translation under stress, it could reduce the chance of starvation by lowering the cell's nutrient requirements.{{cite journal|vauthors=Christensen SK, Mikkelsen M, Pedersen K, Gerdes K|date=December 2001|title=RelE, a global inhibitor of translation, is activated during nutritional stress|journal=Proceedings of the National Academy of Sciences of the United States of America|volume=98|issue=25|pages=14328–33|doi=10.1073/pnas.251327898|pmc=64681|pmid=11717402|bibcode=2001PNAS...9814328C|doi-access=free}} However, it was shown that several toxin-antitoxin systems, including relBE, do not give any competitive advantage under any stress condition.

= Anti-addiction =

It has been proposed that chromosomal homologues of plasmid toxin-antitoxin systems may serve as anti-addiction modules, which would allow progeny to lose a plasmid without suffering the effects of the toxin it encodes. For example, a chromosomal copy of the ccdA antitoxin encoded in the chromosome of Erwinia chrysanthemi is able to neutralize the ccdB toxin encoded on the F plasmid and thus, prevent toxin activation when such a plasmid is lost.{{cite journal | vauthors = Saavedra De Bast M, Mine N, Van Melderen L | title = Chromosomal toxin-antitoxin systems may act as antiaddiction modules | journal = Journal of Bacteriology | volume = 190 | issue = 13 | pages = 4603–9 | date = July 2008 | pmid = 18441063 | pmc = 2446810 | doi = 10.1128/JB.00357-08 }} Similarly, the ataR antitoxin encoded on the chromosome of E. coli O157:H7 is able neutralize the ataTP toxin encoded on plasmids found in other enterohemorragic E. coli.{{cite journal | vauthors = Jurėnas D, Garcia-Pino A, Van Melderen L | title = Novel toxins from type II toxin-antitoxin systems with acetyltransferase activity | journal = Plasmid | volume = 93 | pages = 30–35 | date = September 2017 | pmid = 28941941 | doi = 10.1016/j.plasmid.2017.08.005 | doi-access = free }}

= Phage protection =

Type III toxin-antitoxin (AbiQ) systems have been shown to protect bacteria from bacteriophages altruistically.{{cite journal | vauthors = Emond E, Dion E, Walker SA, Vedamuthu ER, Kondo JK, Moineau S | title = AbiQ, an abortive infection mechanism from Lactococcus lactis | journal = Applied and Environmental Microbiology | volume = 64 | issue = 12 | pages = 4748–56 | date = December 1998 | pmid = 9835558 | pmc = 90918 | doi = 10.1128/AEM.64.12.4748-4756.1998 | bibcode = 1998ApEnM..64.4748E }} During an infection, bacteriophages hijack transcription and translation, which could prevent antitoxin replenishment and release toxin, triggering what is called an "abortive infection". Similar protective effects have been observed with type I,{{cite journal | vauthors = Hazan R, Engelberg-Kulka H | title = Escherichia coli mazEF-mediated cell death as a defense mechanism that inhibits the spread of phage P1 | journal = Molecular Genetics and Genomics | volume = 272 | issue = 2 | pages = 227–34 | date = September 2004 | pmid = 15316771 | doi = 10.1007/s00438-004-1048-y | s2cid = 28840747 }} type II,{{cite journal | vauthors = Pecota DC, Wood TK | title = Exclusion of T4 phage by the hok/sok killer locus from plasmid R1 | journal = Journal of Bacteriology | volume = 178 | issue = 7 | pages = 2044–50 | date = April 1996 | pmid = 8606182 | pmc = 177903 | doi = 10.1128/jb.178.7.2044-2050.1996 }} and type IV (AbiE){{cite journal | vauthors = Dy RL, Przybilski R, Semeijn K, Salmond GP, Fineran PC | title = A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism | journal = Nucleic Acids Research | volume = 42 | issue = 7 | pages = 4590–605 | date = April 2014 | pmid = 24465005 | pmc = 3985639 | doi = 10.1093/nar/gkt1419 }} toxin-antitoxin systems.

Abortive initiation (Abi) can also happen without toxin-antitoxin systems, and many Abi proteins of other types exist. This mechanism serves to halt the replication of phages, protecting the overall population from harm.{{cite journal | vauthors = Seed KD | title = Battling Phages: How Bacteria Defend against Viral Attack | journal = PLOS Pathogens | volume = 11 | issue = 6 | pages = e1004847 | date = June 2015 | pmid = 26066799 | pmc = 4465916 | doi = 10.1371/journal.ppat.1004847 | doi-access = free }}

= Antimicrobial persistence =

When bacteria are challenged with antibiotics, a small and distinct subpopulation of cells is able to withstand the treatment by a phenomenon dubbed as "persistence" (not to be confused with resistance).{{cite journal | vauthors = Kussell E, Kishony R, Balaban NQ, Leibler S | title = Bacterial persistence: a model of survival in changing environments | journal = Genetics | volume = 169 | issue = 4 | pages = 1807–14 | date = April 2005 | pmid = 15687275 | pmc = 1449587 | doi = 10.1534/genetics.104.035352 }} Due to their bacteriostatic properties, type II toxin-antitoxin systems have previously been thought to be responsible for persistence, by switching a fraction of the bacterial population to a dormant state.{{cite journal | vauthors = Maisonneuve E, Gerdes K | title = Molecular mechanisms underlying bacterial persisters | journal = Cell | volume = 157 | issue = 3 | pages = 539–48 | date = April 2014 | pmid = 24766804 | doi = 10.1016/j.cell.2014.02.050 | doi-access = free }} However, this hypothesis has been widely invalidated.{{cite journal | vauthors = Ramisetty BC, Ghosh D, Roy Chowdhury M, Santhosh RS | title = What Is the Link between Stringent Response, Endoribonuclease Encoding Type II Toxin-Antitoxin Systems and Persistence? | language = English | journal = Frontiers in Microbiology | volume = 7 | pages = 1882 | date = 2016 | pmid = 27933045 | pmc = 5120126 | doi = 10.3389/fmicb.2016.01882 | doi-access = free }}{{cite journal | vauthors = Harms A, Fino C, Sørensen MA, Semsey S, Gerdes K | title = Prophages and Growth Dynamics Confound Experimental Results with Antibiotic-Tolerant Persister Cells | journal = mBio | volume = 8 | issue = 6 | pages = e01964–17 | date = December 2017 | pmid = 29233898 | pmc = 5727415 | doi = 10.1128/mBio.01964-17 }}{{cite journal | vauthors = Goormaghtigh F, Fraikin N, Putrinš M, Hallaert T, Hauryliuk V, Garcia-Pino A, Sjödin A, Kasvandik S, Udekwu K, Tenson T, Kaldalu N, Van Melderen L | title = Reassessing the Role of Type II Toxin-Antitoxin Systems in Formation of Escherichia coli Type II Persister Cells | journal = mBio | volume = 9 | issue = 3 | pages = e00640–18 | date = June 2018 | pmid = 29895634 | pmc = 6016239 | doi = 10.1128/mBio.00640-18 }}

= Selfish DNA =

Toxin-antitoxin systems have been used as examples of selfish DNA as part of the gene centered view of evolution. It has been theorised that toxin-antitoxin loci serve only to maintain their own DNA, at the expense of the host organism.{{cite journal | vauthors = Ramisetty BC, Santhosh RS | title = Endoribonuclease type II toxin-antitoxin systems: functional or selfish? | journal = Microbiology | volume = 163 | issue = 7 | pages = 931–939 | date = July 2017 | pmid = 28691660 | doi = 10.1099/mic.0.000487 | s2cid = 3879598 | doi-access = free }} Thus, chromosomal toxin-antitoxin systems would serve no purpose and could be treated as "junk DNA". For example, the ccdAB system encoded in the chromosome of E. coli O157:H7 has been shown to be under negative selection, albeit at a slow rate due to its addictive properties.

System types

=Type I=

File:Hok sok system R1 plasmid present.gif type I toxin-antitoxin system]]

Type I toxin-antitoxin systems rely on the base-pairing of complementary antitoxin RNA with the toxin mRNA. Translation of the mRNA is then inhibited either by degradation via RNase III or by occluding the Shine-Dalgarno sequence or ribosome binding site of the toxin mRNA. Often the toxin and antitoxin are encoded on opposite strands of DNA. The 5' or 3' overlapping region between the two genes is the area involved in complementary base-pairing, usually with between 19–23 contiguous base pairs.{{cite journal | vauthors = Fozo EM, Hemm MR, Storz G | title = Small toxic proteins and the antisense RNAs that repress them | journal = Microbiology and Molecular Biology Reviews | volume = 72 | issue = 4 | pages = 579–89, Table of Contents | date = December 2008 | pmid = 19052321 | pmc = 2593563 | doi = 10.1128/MMBR.00025-08 }}

Toxins of type I systems are small, hydrophobic proteins that confer toxicity by damaging cell membranes. Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts. Also, the detection of small proteins has been challenging due to technical issues, a problem that remains to be solved with large-scale analysis.{{cite journal | vauthors = Sberro H, Fremin BJ, Zlitni S, Edfors F, Greenfield N, Snyder MP, Pavlopoulos GA, Kyrpides NC, Bhatt AS | display-authors = 6 | title = Large-Scale Analyses of Human Microbiomes Reveal Thousands of Small, Novel Genes | journal = Cell | volume = 178 | issue = 5 | pages = 1245–1259.e14 | date = August 2019 | pmid = 31402174 | pmc = 6764417 | doi = 10.1016/j.cell.2019.07.016 }}

Type I systems sometimes include a third component. In the case of the well-characterised hok/sok system, in addition to the hok toxin and sok antitoxin, there is a third gene, called mok. This open reading frame almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component. Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin translation.

{{Clear}}

==Example systems==

class="wikitable sortable" style="margin:auto; border:1px solid gray; clear:both;"
scope="col" style="width:100px;"| Toxin

! scope="col" style="width:100px;"| Antitoxin

! scope="col" style="width:600px;" class="unsortable"|Notes

! scope="col" style="width:25px;" class="unsortable"| Ref.

hok

!sok

| The original and best-understood type I toxin-antitoxin system (pictured), which stabilises plasmids in a number of gram-negative bacteria

|

fst

!RNAII

| The first type I system to be identified in gram-positive bacteria

|{{cite journal | vauthors = Greenfield TJ, Ehli E, Kirshenmann T, Franch T, Gerdes K, Weaver KE | title = The antisense RNA of the par locus of pAD1 regulates the expression of a 33-amino-acid toxic peptide by an unusual mechanism | journal = Molecular Microbiology | volume = 37 | issue = 3 | pages = 652–60 | date = August 2000 | pmid = 10931358 | doi = 10.1046/j.1365-2958.2000.02035.x | doi-access = free }} {{subscription required}}

tisB

!istR

| A chromosomal system induced in the SOS response

|{{cite journal | vauthors = Vogel J, Argaman L, Wagner EG, Altuvia S | title = The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide | journal = Current Biology | volume = 14 | issue = 24 | pages = 2271–6 | date = December 2004 | pmid = 15620655 | doi = 10.1016/j.cub.2004.12.003 | doi-access = free | bibcode = 2004CBio...14.2271V }}

dinQ

!agrB

| A chromosomal system induced in the SOS response

|{{cite journal | vauthors = Weel-Sneve R, Kristiansen KI, Odsbu I, Dalhus B, Booth J, Rognes T, Skarstad K, Bjørås M | title = Single transmembrane peptide DinQ modulates membrane-dependent activities| journal = PLOS Genetics | volume = 9 | issue = 2 | pages = e1003260 | date = February 7, 2013 | pmid = 23408903| doi = 10.1371/journal.pgen.1003260 | pmc = 3567139 | doi-access = free }}

ldrD

!rdlD

| A chromosomal system in Enterobacteriaceae

|{{cite journal | vauthors = Kawano M, Oshima T, Kasai H, Mori H | title = Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli | journal = Molecular Microbiology | volume = 45 | issue = 2 | pages = 333–49 | date = July 2002 | pmid = 12123448 | doi = 10.1046/j.1365-2958.2002.03042.x | doi-access = free }} {{subscription required}}

flmA

!flmB

|A hok/sok homologue, which also stabilises the F plasmid

|{{cite journal | vauthors = Loh SM, Cram DS, Skurray RA | title = Nucleotide sequence and transcriptional analysis of a third function (Flm) involved in F-plasmid maintenance | journal = Gene | volume = 66 | issue = 2 | pages = 259–68 | date = June 1988 | pmid = 3049248 | doi = 10.1016/0378-1119(88)90362-9 }}

ibs

!sib

|Discovered in E. coli intergenic regions, the antitoxin was originally named QUAD RNA

|{{cite journal | vauthors = Fozo EM, Kawano M, Fontaine F, Kaya Y, Mendieta KS, Jones KL, Ocampo A, Rudd KE, Storz G | title = Repression of small toxic protein synthesis by the Sib and OhsC small RNAs | journal = Molecular Microbiology | volume = 70 | issue = 5 | pages = 1076–93 | date = December 2008 | pmid = 18710431 | pmc = 2597788 | doi = 10.1111/j.1365-2958.2008.06394.x }} {{subscription required}}

txpA/brnT

!ratA

|Ensures the inheritance of the skin element during sporulation in Bacillus subtilis

|{{cite journal | vauthors = Silvaggi JM, Perkins JB, Losick R | title = Small untranslated RNA antitoxin in Bacillus subtilis | journal = Journal of Bacteriology | volume = 187 | issue = 19 | pages = 6641–50 | date = October 2005 | pmid = 16166525 | pmc = 1251590 | doi = 10.1128/JB.187.19.6641-6650.2005 }}

symE

!symR

|A chromosomal system induced in the SOS response

|

XCV2162

!ptaRNA1

|A system identified in Xanthomonas campestris with erratic phylogenetic distribution.

|{{cite journal | vauthors = Findeiss S, Schmidtke C, Stadler PF, Bonas U | title = A novel family of plasmid-transferred anti-sense ncRNAs | journal = RNA Biology | volume = 7 | issue = 2 | pages = 120–4 | date = March 2010 | pmid = 20220307 | doi = 10.4161/rna.7.2.11184 | doi-access = free }}

timP

!timR

|A chromosomal system identified in Salmonella

|{{cite journal | vauthors = Andresen L, Martínez-Burgo Y, Nilsson Zangelin J, Rizvanovic A, Holmqvist E | title = Salmonella Protein TimP Targets the Cytoplasmic Membrane and Is Repressed by the Small RNA TimR | journal = mBio | volume = 11 | issue = 6 | pages = e01659–20, /mbio/11/6/mBio.01659–20.atom | date = November 2020 | pmid = 33172998 | doi = 10.1128/mBio.01659-20| pmc = 7667032 | doi-access = free }}

aapA1

!isoA1

|A type 1 TA module in Helicobacter pylori

|{{cite journal | vauthors = Arnion H, Korkut DN, Masachis Gelo S, Chabas S, Reignier J, Iost I, Darfeuille F | title = Mechanistic insights into type I toxin antitoxin systems in Helicobacter pylori: the importance of mRNA folding in controlling toxin expression | journal = Nucleic Acids Research | volume = 45 | issue = 8 | pages = 4782–4795 | date = May 2017 | pmid = 28077560 | doi = 10.1093/nar/gkw1343 | pmc = 5416894 | doi-access = free }}

sprA1

!sprA1as

|Located within S. aureus small Pathogenicity island (SaPI). SprA1 encodes for a small cytotoxic peptide, PepA1, which disrupts both S. aureus membranes and host erythrocytes.

|{{cite journal | vauthors = Sayed N, Jousselin A, Felden B | title = A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide | journal = Nature Structural & Molecular Biology | volume = 19 | issue = 1 | pages = 105–12 | date = December 2011 | pmid = 22198463 | doi = 10.1038/nsmb.2193 | s2cid = 8217681 | url = http://www.hal.inserm.fr/inserm-00696345/document }}{{cite journal | vauthors = Sayed N, Nonin-Lecomte S, Réty S, Felden B | title = Functional and structural insights of a Staphylococcus aureus apoptotic-like membrane peptide from a toxin-antitoxin module | journal = The Journal of Biological Chemistry | volume = 287 | issue = 52 | pages = 43454–63 | date = December 2012 | pmid = 23129767 | pmc = 3527932 | doi = 10.1074/jbc.M112.402693 | doi-access = free }}

=Type II=

File:Typical TA sys.png analysis{{cite journal | vauthors = Sevin EW, Barloy-Hubler F | title = RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes | journal = Genome Biology | volume = 8 | issue = 8 | pages = R155 | year = 2007 | pmid = 17678530 | pmc = 2374986 | doi = 10.1186/gb-2007-8-8-r155 | doi-access = free }}]]

Type II toxin-antitoxin systems are generally better-understood than type I. In this system a labile proteic antitoxin tightly binds and inhibits the activity of a stable toxin. The largest family of type II toxin-antitoxin systems is vapBC,{{cite journal | vauthors = Robson J, McKenzie JL, Cursons R, Cook GM, Arcus VL | title = The vapBC operon from Mycobacterium smegmatis is an autoregulated toxin-antitoxin module that controls growth via inhibition of translation | journal = Journal of Molecular Biology | volume = 390 | issue = 3 | pages = 353–67 | date = July 2009 | pmid = 19445953 | doi = 10.1016/j.jmb.2009.05.006 }} which has been found through bioinformatics searches to represent between 37 and 42% of all predicted type II loci. Type II systems are organised in operons with the antitoxin protein typically being located upstream of the toxin, which helps to prevent expression of the toxin without the antitoxin.{{cite journal | vauthors = Deter HS, Jensen RV, Mather WH, Butzin NC | title = Mechanisms for Differential Protein Production in Toxin-Antitoxin Systems | journal = Toxins | volume = 9 | issue = 7 | page = 211 | date = July 2017 | pmid = 28677629 | pmc = 5535158 | doi = 10.3390/toxins9070211 | doi-access = free }} The proteins are typically around 100 amino acids in length, and exhibit toxicity in a number of ways: CcdB, for example, affects DNA replication by poisoning DNA gyrase{{cite journal | vauthors = Bernard P, Couturier M | title = Cell killing by the F plasmid CcdB protein involves poisoning of DNA-topoisomerase II complexes | journal = Journal of Molecular Biology | volume = 226 | issue = 3 | pages = 735–45 | date = August 1992 | pmid = 1324324 | doi = 10.1016/0022-2836(92)90629-X }} whereas toxins from the MazF family are endoribonucleases that cleave cellular mRNAs,{{cite journal | vauthors = Zhang Y, Zhang J, Hoeflich KP, Ikura M, Qing G, Inouye M | title = MazF cleaves cellular mRNAs specifically at ACA to block protein synthesis in Escherichia coli | journal = Molecular Cell | volume = 12 | issue = 4 | pages = 913–23 | date = October 2003 | pmid = 14580342 | doi = 10.1016/s1097-2765(03)00402-7 | doi-access = free }}{{cite journal | vauthors = Culviner PH, Laub MT | title = Global Analysis of the E. coli Toxin MazF Reveals Widespread Cleavage of mRNA and the Inhibition of rRNA Maturation and Ribosome Biogenesis | journal = Molecular Cell | volume = 70 | issue = 5 | pages = 868–880.e10 | date = June 2018 | pmid = 29861158 | doi = 10.1016/j.molcel.2018.04.026 | pmc = 8317213 | doi-access = free }} tRNAs {{cite journal | vauthors = Barth VC, Zeng JM, Vvedenskaya IO, Ouyang M, Husson RN, Woychik NA | title = Toxin-mediated ribosome stalling reprograms the Mycobacterium tuberculosis proteome | journal = Nature Communications | volume = 10 | issue = 1 | pages = 3035 | date = July 2019 | pmid = 31292443 | pmc = 6620280 | doi = 10.1038/s41467-019-10869-8 | bibcode = 2019NatCo..10.3035B }}{{cite journal | vauthors = Barth VC, Woychik NA | title = The Sole Mycobacterium smegmatis MazF Toxin Targets tRNALys to Impart Highly Selective, Codon-Dependent Proteome Reprogramming | journal = Frontiers in Genetics | volume = 10 | pages = 1356 | date = 2019 | pmid = 32117414 | pmc = 7033543 | doi = 10.3389/fgene.2019.01356 | doi-access = free }} or rRNAs {{cite journal | vauthors = Schifano JM, Edifor R, Sharp JD, Ouyang M, Konkimalla A, Husson RN, Woychik NA | title = Mycobacterial toxin MazF-mt6 inhibits translation through cleavage of 23S rRNA at the ribosomal A site | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 110 | issue = 21 | pages = 8501–6 | date = May 2013 | pmid = 23650345 | pmc = 3666664 | doi = 10.1073/pnas.1222031110 | bibcode = 2013PNAS..110.8501S | doi-access = free }} at specific sequence motifs. The most common toxic activity is the protein acting as an endonuclease, also known as an interferase.{{cite book | vauthors = Christensen-Dalsgaard M, Overgaard M, Winther KS, Gerdes K | chapter = Chapter 25 RNA Decay by Messenger RNA Interferases | title = RNA Turnover in Bacteria, Archaea and Organelles | volume = 447 | pages = 521–35 | year = 2008 | pmid = 19161859 | doi = 10.1016/S0076-6879(08)02225-8 | isbn = 978-0-12-374377-0 | series = Methods in Enzymology }}{{cite book | vauthors = Yamaguchi Y, Inouye M | title = mRNA interferases, sequence-specific endoribonucleases from the toxin-antitoxin systems | chapter = Chapter 12 mRNA Interferases, Sequence-Specific Endoribonucleases from the Toxin–Antitoxin Systems | volume = 85 | pages = 467–500 | year = 2009 | pmid = 19215780 | doi = 10.1016/S0079-6603(08)00812-X | isbn = 978-0-12-374761-7 | series = Progress in Molecular Biology and Translational Science }}

One of the key features of the TAs is the autoregulation. The antitoxin and toxin protein complex bind to the operator that is present upstream of the TA genes. This results in repression of the TA operon. The key to the regulation are (i) the differential translation of the TA proteins and (ii) differential proteolysis of the TA proteins. As explained by the "Translation-reponsive model",{{cite journal | vauthors = Ramisetty BC | title = Regulation of Type II Toxin-Antitoxin Systems: The Translation-Responsive Model | language = English | journal = Frontiers in Microbiology | volume = 11 | pages = 895 | date = 2020 | pmid = 32431690 | doi = 10.3389/fmicb.2020.00895 | pmc = 7214741 | doi-access = free }} the degree of expression is inversely proportional to the concentration of the repressive TA complex. The TA complex concentration is directly proportional to the global translation rate. The higher the rate of translation more TA complex and less transcription of TA mRNA. Lower the rate of translation, lesser the TA complex and higher the expression. Hence, the transcriptional expression of TA operon is inversely proportional to translation rate.

A third protein can sometimes be involved in type II toxin-antitoxin systems. in the case of the ω-ε-ζ (omega-epsilon-zeta) system, the omega protein is a DNA binding protein that negatively regulates the transcription of the whole system. Similarly, the paaR2 protein regulates the expression of the paaR2-paaA2-parE2 toxin-antitoxin system.{{cite journal | vauthors = Hallez R, Geeraerts D, Sterckx Y, Mine N, Loris R, Van Melderen L | title = New toxins homologous to ParE belonging to three-component toxin-antitoxin systems in Escherichia coli O157:H7 | journal = Molecular Microbiology | volume = 76 | issue = 3 | pages = 719–32 | date = May 2010 | pmid = 20345661 | doi = 10.1111/j.1365-2958.2010.07129.x | url = https://hal.archives-ouvertes.fr/hal-00552629/file/PEER_stage2_10.1111%252Fj.1365-2958.2010.07129.x.pdf | doi-access = free }} Other toxin-antitoxin systems can be found with a chaperone as a third component.{{cite journal | vauthors = Bordes P, Cirinesi AM, Ummels R, Sala A, Sakr S, Bitter W, Genevaux P | title = SecB-like chaperone controls a toxin-antitoxin stress-responsive system in Mycobacterium tuberculosis | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 108 | issue = 20 | pages = 8438–43 | date = May 2011 | pmid = 21536872 | pmc = 3100995 | doi = 10.1073/pnas.1101189108 | bibcode = 2011PNAS..108.8438B | doi-access = free }} This chaperone is essential for proper folding of the antitoxin, thus making the antitoxin addicted to its cognate chaperone.

==Example systems==

class="wikitable sortable" style="margin:auto; border:1px solid gray; clear:both;"
scope="col" style="width:100px;"| Toxin

! scope="col" style="width:100px;"| Antitoxin

! scope="col" style="width:600px;" class="unsortable"|Notes

! scope="col" style="width:25px;" class="unsortable"| Ref.

ccdB

!ccdA

|Found on the F plasmid of Escherichia coli

|

parE

!parD

|Found in multiple copies in Caulobacter crescentus

|{{cite journal | vauthors = Fiebig A, Castro Rojas CM, Siegal-Gaskins D, Crosson S | title = Interaction specificity, toxicity and regulation of a paralogous set of ParE/RelE-family toxin-antitoxin systems | journal = Molecular Microbiology | volume = 77 | issue = 1 | pages = 236–51 | date = July 2010 | pmid = 20487277 | pmc = 2907451 | doi = 10.1111/j.1365-2958.2010.07207.x }} {{subscription required}}

mazF

!mazE

|Found in E. coli and in chromosomes of other bacteria

|

yafO

!yafN

|A system induced by the SOS response to DNA damage in E. coli

|{{cite journal|vauthors=Singletary LA, Gibson JL, Tanner EJ, McKenzie GJ, Lee PL, Gonzalez C, Rosenberg SM|date=December 2009|title=An SOS-regulated type 2 toxin-antitoxin system|journal=Journal of Bacteriology|volume=191|issue=24|pages=7456–65|doi=10.1128/JB.00963-09|pmc=2786605|pmid=19837801}}

hicA

!hicB

|Found in archaea and bacteria

|{{cite journal | vauthors = Jørgensen MG, Pandey DP, Jaskolska M, Gerdes K | title = HicA of Escherichia coli defines a novel family of translation-independent mRNA interferases in bacteria and archaea | journal = Journal of Bacteriology | volume = 191 | issue = 4 | pages = 1191–9 | date = February 2009 | pmid = 19060138 | pmc = 2631989 | doi = 10.1128/JB.01013-08 }}

kid

!kis

|Stabilises the R1 plasmid and is related to the CcdB/A system

|

ζ

!ε

|Found mostly in Gram-positive bacteria

|{{cite journal | vauthors = Mutschler H, Meinhart A | title = ε/ζ systems: their role in resistance, virulence, and their potential for antibiotic development | journal = Journal of Molecular Medicine | volume = 89 | issue = 12 | pages = 1183–94 | date = December 2011 | pmid = 21822621 | pmc = 3218275 | doi = 10.1007/s00109-011-0797-4 }}

ataT

!ataR

|Found in enterohemorragic E. coli and Klebsiella spp.

|{{cite journal | vauthors = Jurėnas D, Chatterjee S, Konijnenberg A, Sobott F, Droogmans L, Garcia-Pino A, Van Melderen L | title = fMet | journal = Nature Chemical Biology | volume = 13 | issue = 6 | pages = 640–646 | date = June 2017 | pmid = 28369041 | doi = 10.1038/nchembio.2346 | url = http://eprints.whiterose.ac.uk/118591/13/AtaT%20blocks%20translation%20initiation%20AAM.pdf }}

=Type III=

{{Infobox protein family

| Symbol = ToxN, type III toxin-antitoxin system

| Name = ToxN_toxin

| image =

| width =

| caption =

| Pfam = PF13958

| Pfam_clan =

| InterPro =

| SMART =

| PROSITE =

| MEROPS =

| SCOP =

| TCDB =

| OPM family =

| OPM protein =

| CAZy =

| CDD =

}}

Type III toxin-antitoxin systems rely on direct interaction between a toxic protein and an RNA antitoxin. The toxic effects of the protein are neutralised by the RNA gene. One example is the ToxIN system from the bacterial plant pathogen Erwinia carotovora. The toxic ToxN protein is approximately 170 amino acids long and has been shown to be toxic to E. coli. The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC).{{cite journal | vauthors = Fineran PC, Blower TR, Foulds IJ, Humphreys DP, Lilley KS, Salmond GP | title = The phage abortive infection system, ToxIN, functions as a protein-RNA toxin-antitoxin pair | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 106 | issue = 3 | pages = 894–9 | date = January 2009 | pmid = 19124776 | pmc = 2630095 | doi = 10.1073/pnas.0808832106 | bibcode = 2009PNAS..106..894F | doi-access = free }}{{cite journal | vauthors = Blower TR, Fineran PC, Johnson MJ, Toth IK, Humphreys DP, Salmond GP | title = Mutagenesis and functional characterization of the RNA and protein components of the toxIN abortive infection and toxin-antitoxin locus of Erwinia | journal = Journal of Bacteriology | volume = 191 | issue = 19 | pages = 6029–39 | date = October 2009 | pmid = 19633081 | pmc = 2747886 | doi = 10.1128/JB.00720-09 }} Crystallographic analysis of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.{{cite journal | vauthors = Blower TR, Pei XY, Short FL, Fineran PC, Humphreys DP, Luisi BF, Salmond GP | title = A processed noncoding RNA regulates an altruistic bacterial antiviral system | journal = Nature Structural & Molecular Biology | volume = 18 | issue = 2 | pages = 185–90 | date = February 2011 | pmid = 21240270 | doi = 10.1038/nsmb.1981 | pmc = 4612426 }}

= Type IV =

Type IV toxin-antitoxin systems are similar to type II systems, because they consist of two proteins. Unlike type II systems, the antitoxin in type IV toxin-antitoxin systems counteracts the activity of the toxin, and the two proteins do not necessarily interact directly. DarTG1 and DarTG2 are type IV toxin-antitoxin systems that modify DNA. Their toxins add ADP-ribose to guanosine bases (DarT1 toxin) or thymidine bases (DarT2 toxin), and their antitoxins remove the toxic modifications (NADAR antitoxin from guanosine and DarG antitoxin from thymidine).{{cite journal | vauthors = Brown JM, Shaw KJ | title = A novel family of Escherichia coli toxin-antitoxin gene pairs | journal = Journal of Bacteriology | volume = 185 | issue = 22 | pages = 6600–8 | date = November 2003 | pmid = 14594833 | pmc = 262102 | doi = 10.1128/jb.185.22.6600-6608.2003 }}{{cite journal | vauthors = Jankevicius G, Ariza A, Ahel M, Ahel I | title = The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA | journal = Molecular Cell | volume = 64 | issue = 6 | pages = 1109–1116 | date = December 2016 | pmid = 27939941 | pmc = 5179494 | doi = 10.1016/j.molcel.2016.11.014 }}{{cite journal | vauthors = Schuller M, Butler RE, Ariza A, Tromans-Coia C, Jankevicius G, Claridge TD, Kendall SL, Goh S, Stewart GR, Ahel I | display-authors = 6 | title = Molecular basis for DarT ADP-ribosylation of a DNA base | journal = Nature | volume = 596 | issue = 7873 | pages = 597–602 | date = August 2021 | pmid = 34408320 | doi = 10.1038/s41586-021-03825-4 | bibcode = 2021Natur.596..597S | s2cid = 237214909 | hdl = 2299/25013 | hdl-access = free }}{{Cite journal |last1=Schuller |first1=Marion |last2=Raggiaschi |first2=Roberto |last3=Mikolcevic |first3=Petra |last4=Rack |first4=Johannes G. M. |last5=Ariza |first5=Antonio |last6=Zhang |first6=YuGeng |last7=Ledermann |first7=Raphael |last8=Tang |first8=Christoph |last9=Mikoc |first9=Andreja |last10=Ahel |first10=Ivan |date=2023-07-06 |title=Molecular basis for the reversible ADP-ribosylation of guanosine bases |journal=Molecular Cell |language=en |volume=83 |issue=13 |pages=2303–2315.e6 |doi=10.1016/j.molcel.2023.06.013 |pmid=37390817 |s2cid=259304277 |issn=1097-2765|doi-access=free |pmc=11543638 }}

= Type V =

ghoST is a type V toxin-antitoxin system, in which the antitoxin (GhoS) cleaves the ghoT mRNA. This system is regulated by a type II system, mqsRA.{{cite journal | vauthors = Wang X, Lord DM, Hong SH, Peti W, Benedik MJ, Page R, Wood TK | title = Type II toxin/antitoxin MqsR/MqsA controls type V toxin/antitoxin GhoT/GhoS | journal = Environmental Microbiology | volume = 15 | issue = 6 | pages = 1734–44 | date = June 2013 | pmid = 23289863 | pmc = 3620836 | doi = 10.1111/1462-2920.12063 | bibcode = 2013EnvMi..15.1734W }}

= Type VI =

socAB is a type VI toxin-antitoxin system that was discovered in Caulobacter crescentus. The antitoxin, SocA, promotes degradation of the toxin, SocB, by the protease ClpXP.{{cite journal | vauthors = Aakre CD, Phung TN, Huang D, Laub MT | title = A bacterial toxin inhibits DNA replication elongation through a direct interaction with the β sliding clamp | journal = Molecular Cell | volume = 52 | issue = 5 | pages = 617–28 | date = December 2013 | pmid = 24239291 | pmc = 3918436 | doi = 10.1016/j.molcel.2013.10.014 }}

= Type VII =

Type VII has been proposed to include systems hha/tomB, tglT/takA and hepT/mntA, all of which neutralise toxin activity by post-translational chemical modification of amino acid residues.{{cite journal | vauthors = Wang X, Yao J, Sun YC, Wood TK | title = Type VII Toxin/Antitoxin Classification System for Antitoxins that Enzymatically Neutralize Toxins | journal = Trends in Microbiology | volume = 29 | issue = 5 | pages = 388–393 | date = May 2021 | pmid = 33342606 | doi = 10.1016/j.tim.2020.12.001 | s2cid = 229341165 }}

= Type VIII =

Type VIII includes the system creTA. In this system, the antitoxin creA serves as a guide RNA for a CRISPR-Cas system. Due to incomplete complementarity between the creA guide and the creAT promoter, the Cas complex does not cleave the DNA, but instead remains at the site, where it blocks access by RNA polymerase, preventing expression of the creT toxin (a natural instance of CRISPRi). When expressed, the creT RNA will sequester the rare arginine codon tRNAUCU, stalling translation and halting cell metabolism.{{Cite journal |last1=Li |first1=Ming |last2=Gong |first2=Luyao |last3=Cheng |first3=Feiyue |last4=Yu |first4=Haiying |last5=Zhao |first5=Dahe |last6=Wang |first6=Rui |last7=Wang |first7=Tian |last8=Zhang |first8=Shengjie |last9=Zhou |first9=Jian |last10=Shmakov |first10=Sergey A. |last11=Koonin |first11=Eugene V. |last12=Xiang |first12=Hua |date=2021-04-30 |title=Toxin-antitoxin RNA pairs safeguard CRISPR-Cas systems |url=https://www.science.org/doi/10.1126/science.abe5601 |journal=Science |language=en |volume=372 |issue=6541 |pages=eabe5601 |doi=10.1126/science.abe5601 |pmid=33926924 |s2cid=233448823 |issn=0036-8075|url-access=subscription }}

Biotechnological applications

The biotechnological applications of toxin-antitoxin systems have begun to be realised by several biotechnology organisations.{{cite journal | vauthors = Diago-Navarro E, Hernandez-Arriaga AM, López-Villarejo J, Muñoz-Gómez AJ, Kamphuis MB, Boelens R, Lemonnier M, Díaz-Orejas R | title = parD toxin-antitoxin system of plasmid R1--basic contributions, biotechnological applications and relationships with closely-related toxin-antitoxin systems | journal = The FEBS Journal | volume = 277 | issue = 15 | pages = 3097–117 | date = August 2010 | pmid = 20569269 | doi = 10.1111/j.1742-4658.2010.07722.x | doi-access = free }} A primary usage is in maintaining plasmids in a large bacterial cell culture. In an experiment examining the effectiveness of the hok/sok locus, it was found that segregational stability of an inserted plasmid expressing beta-galactosidase was increased by between 8 and 22 times compared to a control culture lacking a toxin-antitoxin system.{{cite journal | vauthors = Wu K, Jahng D, Wood TK | title = Temperature and growth rate effects on the hok/sok killer locus for enhanced plasmid stability | journal = Biotechnology Progress | volume = 10 | issue = 6 | pages = 621–9 | year = 1994 | pmid = 7765697 | doi = 10.1021/bp00030a600 | s2cid = 34815594 }}{{cite journal | vauthors = Pecota DC, Kim CS, Wu K, Gerdes K, Wood TK | title = Combining the hok/sok, parDE, and pnd postsegregational killer loci to enhance plasmid stability | journal = Applied and Environmental Microbiology | volume = 63 | issue = 5 | pages = 1917–24 | date = May 1997 | pmid = 9143123 | pmc = 168483 | doi = 10.1128/AEM.63.5.1917-1924.1997| bibcode = 1997ApEnM..63.1917P }} In large-scale microorganism processes such as fermentation, progeny cells lacking the plasmid insert often have a higher fitness than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process.

Additionally, toxin-antitoxin systems may be a future target for antibiotics. Inducing suicide modules against pathogens could help combat the growing problem of multi-drug resistance.{{cite journal | vauthors = Gerdes K, Christensen SK, Løbner-Olesen A | title = Prokaryotic toxin-antitoxin stress response loci | journal = Nature Reviews. Microbiology | volume = 3 | issue = 5 | pages = 371–82 | date = May 2005 | pmid = 15864262 | doi = 10.1038/nrmicro1147 | s2cid = 13417307 }}

Ensuring a plasmid accepts an insert is a common problem of DNA cloning. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from the ccdB-encoded toxin, which has been incorporated into plasmid vectors.{{cite journal | vauthors = Bernard P, Gabant P, Bahassi EM, Couturier M | title = Positive-selection vectors using the F plasmid ccdB killer gene | journal = Gene | volume = 148 | issue = 1 | pages = 71–4 | date = October 1994 | pmid = 7926841 | doi = 10.1016/0378-1119(94)90235-6 }} The gene of interest is then targeted to recombine into the ccdB locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive.

Another example application involves both the CcdB toxin and CcdA antitoxin. CcdB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures orientation-specific gene insertion.

Genetically modified organisms must be contained in a pre-defined area during research. Toxin-antitoxin systems can cause cell suicide in certain conditions, such as a lack of a lab-specific growth medium they would not encounter outside of the controlled laboratory set-up.{{cite journal | vauthors = Torres B, Jaenecke S, Timmis KN, García JL, Díaz E | title = A dual lethal system to enhance containment of recombinant micro-organisms | journal = Microbiology | volume = 149 | issue = Pt 12 | pages = 3595–601 | date = December 2003 | pmid = 14663091 | doi = 10.1099/mic.0.26618-0 | doi-access = free }}

See also

References

{{Reflist|32em}}