Login
Login

haplogroup I-M170

{{short description|Human Y-chromosome DNA haplogroup}}

{{about|the human Y-DNA haplogroup|the human mtDNA haplogroup|Haplogroup I (mtDNA)}}

{{Expert needed|Human Genetic History|talk=|reason=Nomenclature of haplogroup(s) and subclades|date=January 2016}}

{{Lead rewrite|date=January 2023}}

{{Infobox haplogroup

| name =I-M170

| map = Haplogrupo I (Y-DNA).png

| origin-date =~42,900 Years BP [https://www.yfull.com/tree/I/]

| origin-place = Europe

| ancestor =IJ

| descendants =I*, I1, I2

| mutations =L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, U179

| members Bosnia and Herzegovina 53%,Marjanović, Damir; et al. "The peopling of modern Bosnia-Herzegovina: Y-chromosome haplogroups in the three main ethnic groups." Institute for Genetic Engineering and Biotechnology, University of Sarajevo. November 2005 Sweden 42%,{{cite journal | last1 = Rootsi | first1 = S | last2 = Magri | first2 = C | last3 = Kivisild | first3 = T| year = 2004| title = (July 2004). "Phylogeography of Y-chromosome haplogroup I-M170 reveals distinct domains of prehistoric gene flow in europe | journal = Am. J. Hum. Genet. | volume = 75 | issue = 1| pages = 128–37 | doi = 10.1086/422196 | pmid = 15162323 | pmc=1181996|display-authors=etal}} Norway 40%, Croatia (mainland) 38%,{{cite journal | last1 = Pericić | first1 = M | last2 = Lauc | first2 = LB | last3 = Klarić | first3 = IM| year = 2005 | title = High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations | journal = Mol. Biol. Evol. | volume = 22 | issue = 10| pages = 1964–75 | doi = 10.1093/molbev/msi185 | pmid = 15944443 |quote=Fig. 3. — I1b* (xM26) frequency and variance surfaces ...|display-authors=etal| doi-access = free }}|TMRCA=~27,500 Years BP [https://www.yfull.com/tree/I/]}}

Haplogroup I (M170) is a Y-chromosome DNA haplogroup. It is a subgroup of haplogroup IJ, which itself is a derivative of the haplogroup IJK. Subclades I1 and I2 can be found in most present-day European populations, with peaks in some Northern European and Southeastern European countries.

Haplogroup I most likely arose in Europe,{{Cite journal |last=Львович |first=Рожанский Игорь |date=2021 |title=ОБЗОР ДАННЫХ ИСКОПАЕМОЙ ДНК: ГАПЛОКАРТЫ G И I |url=https://cyberleninka.ru/article/n/obzor-dannyh-iskopaemoy-dnk-gaplokarty-g-i-i |journal=Исторический формат |issue=4 (28) |pages=125–140}} with it so far found in Palaeolithic sites throughout Europe, but not outside it. It diverged from common ancestor IJ* about 43,000 years ago. Early evidence for haplogroup J has been found in the Caucasus and Iran. In addition, living examples of the precursor Haplogroup IJ* have been found only in Iran, among the Mazandarani and ethnic Persians from Fars.{{cite journal | last1 = Grugni | year = 2012 | title = Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians | journal = PLOS One | volume = 7| issue = 7| pages = e41252| doi = 10.1371/journal.pone.0041252 | pmid=22815981 | pmc=3399854| bibcode = 2012PLoSO...741252G | doi-access = free }} This may indicate that IJ originated in South West Asia.

The oldest example found was originally that of Paglicci133 from Italy, which is at least 31,000 years old,{{cite journal |last1=Fu |first1=Qiaomei |display-authors=etal |year=2016 |title=The genetic history of Ice Age Europe |journal=Nature |volume=534 |issue=7606 |pages=200–5 |bibcode=2016Natur.534..200F |doi=10.1038/nature17993 |pmc=4943878 |pmid=27135931}} however, in a later study this was changed, and instead Dolní Věstonice (DV14) from the Czech Republic was reported as the oldest, being at least 30,800 years old.{{Cite journal |last=Posth |first=Cosimo |last2=Yu |first2=He |last3=Ghalichi |first3=Ayshin |last4=Rougier |first4=Hélène |last5=Crevecoeur |first5=Isabelle |last6=Huang |first6=Yilei |last7=Ringbauer |first7=Harald |last8=Rohrlach |first8=Adam B. |last9=Nägele |first9=Kathrin |last10=Villalba-Mouco |first10=Vanessa |last11=Radzeviciute |first11=Rita |last12=Ferraz |first12=Tiago |last13=Stoessel |first13=Alexander |last14=Tukhbatova |first14=Rezeda |last15=Drucker |first15=Dorothée G. |date=2023-03-01 |title=Palaeogenomics of Upper Palaeolithic to Neolithic European hunter-gatherers |url=https://www.nature.com/articles/s41586-023-05726-0 |journal=Nature |language=en |volume=615 |issue=7950 |pages=117–126 |doi=10.1038/s41586-023-05726-0 |issn=1476-4687|hdl=10256/23099 |hdl-access=free }}

Haplogroup I has been found in multiple individuals belonging to the Gravettian culture. The Gravettians expanded westwards from the far corner of Eastern Europe, likely Russia, to Central Europe. They are associated with a genetic cluster that is normally called the Věstonice cluster.{{Cite web|title=Publications Detail View|url=https://fgga.univie.ac.at/en/research/publications/publications-detail-view/?tx_univiepure_univiepure%5Buuid%5D=cb9edcf2-a5ca-469d-bd5b-c8021203aacc&tx_univiepure_univiepure%5Bwhat2show%5D=publ&tx_univiepure_univiepure%5Baction%5D=show&tx_univiepure_univiepure%5Bcontroller%5D=Pure&cHash=61ab4ac40430e51782aeea80a7bc7258|access-date=2020-12-15|website=fgga.univie.ac.at|language=en}}{{Cite journal|last1=Mounier|first1=Aurélien|last2=Heuzé|first2=Yann|last3=Samsel|first3=Mathilde|last4=Vasilyev|first4=Sergey|last5=Klaric|first5=Laurent|last6=Villotte|first6=Sébastien|date=2020-12-14|title=Gravettian cranial morphology and human group affinities during the European Upper Palaeolithic|journal=Scientific Reports|language=en|volume=10|issue=1|pages=21931|doi=10.1038/s41598-020-78841-x|pmid=33318530|pmc=7736346|bibcode=2020NatSR..1021931M|issn=2045-2322|doi-access=free}}{{Cite journal|last1=Bennett|first1=E. Andrew|last2=Prat|first2=Sandrine|last3=Péan|first3=Stéphane|last4=Crépin|first4=Laurent|last5=Yanevich|first5=Alexandr|last6=Puaud|first6=Simon|last7=Grange|first7=Thierry|last8=Geigl|first8=Eva-Maria|date=2019-07-02|title=The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European|url=https://www.biorxiv.org/content/10.1101/685404v2|journal=bioRxiv|language=en|pages=685404|doi=10.1101/685404|s2cid=198249005|doi-access=free}}

Origins

File:Cro-Magnon_migration.gif]] File:Europe20000ya.png refuges, 20,000 years BP.

{{legend|#c54b00|Solutrean and Proto-Solutrean Cultures}}

{{legend|#ca00b0|Epi-Gravettian Culture}}

]]

Available evidence suggests that I-M170 was preceded into areas in which it would later become dominant by haplogroups K2a (K-M2308) and C1 (Haplogroup C-F3393). K2a and C1 have been found in the oldest sequenced male remains from Western Eurasia (dating from circa 45,000 to 35,000 years BP), such as: Ust'-Ishim man (modern west Siberia) K2a*, Oase 1 (Romania) K2a*, Kostenki 14 (south west Russia) C1b, and Goyet Q116-1 (Belgium) C1a.{{cite journal | last1 = Fu | first1 = Qiaomei | display-authors = etal | year = 2016 | title = The genetic history of Ice Age Europe | journal = Nature | volume = 534| issue = 7606| pages = 200–5| doi = 10.1038/nature17993 | pmid = 27135931 | bibcode = 2016Natur.534..200F | pmc = 4943878 }}Seguin-Orlando et al. (2014)「[http://science.sciencemag.org/content/346/6213/1113　Genomic structure in Europeans dating back at least 36,200 years]」 The oldest I-M170 found is that of an individual known as Krems WA3 (lower Austria), dating from circa 33,000-24,000 BP. At the same site, two twin boys were also found, both were assigned to haplogroup I*.{{Cite journal|last1=Teschler-Nicola|first1=Maria|last2=Fernandes|first2=Daniel|last3=Händel|first3=Marc|last4=Einwögerer|first4=Thomas|last5=Simon|first5=Ulrich|last6=Neugebauer-Maresch|first6=Christine|last7=Tangl|first7=Stefan|last8=Heimel|first8=Patrick|last9=Dobsak|first9=Toni|last10=Retzmann|first10=Anika|last11=Prohaska|first11=Thomas|date=2020-11-06|title=Ancient DNA reveals monozygotic newborn twins from the Upper Palaeolithic|journal=Communications Biology|language=en|volume=3|issue=1|page=650|doi=10.1038/s42003-020-01372-8|pmid=33159107|pmc=7648643|issn=2399-3642|doi-access=free}}{{Cite web|date=2016-05-11|title=Y-SNP calls for Krems WA3|url=https://genetiker.wordpress.com/y-snp-calls-for-krems-wa3/|access-date=2020-12-15|website=Genetiker|language=en}}

Haplogroup IJ was in the Middle East and/or Europe about 40,000 years ago.{{citation needed|date=January 2018}} The TMRCA (time to most recent common ancestor) for I-M170 was estimated by Karafet and colleagues in 2008 to be 22,200 years ago, with a confidence interval between 15,300 and 30,000 years ago.{{cite journal |vauthors=Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF |title=New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree |journal=Genome Research |year=2008 |volume=18 |pages=830–8 |doi=10.1101/gr.7172008 |url=http://www.genome.org/cgi/content/abstract/gr.7172008v1 |pmid=18385274 |issue=5 |pmc=2336805}} This would make the founding event of I-M170 approximately contemporaneous with the Last Glacial Maximum (LGM), which lasted from 26,500 years ago until approximately 19,500 years ago.{{cite journal|title=The Last Glacial Maximum|doi=10.1126/science.1172873 |pmid=19661421|volume=325|issue=5941|date=August 2009|journal=Science|pages=710–4 |vauthors=Clark PU, Dyke AS, Shakun JD|display-authors=etal |bibcode=2009Sci...325..710C|s2cid=1324559 }} TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I-M170 they estimate time to STR variation as 24,000 ±7,100 years ago and time to population divergence as 23,000 ±7,700 years ago.{{cite journal | doi = 10.1086/422196 | author = Rootsi Siiri | year = 2004 | title = Phylogeography of Y-Chromosome Haplogroup I-M170 Reveals Distinct Domains of Prehistoric Gene Flow in Europe | journal = American Journal of Human Genetics | volume = 75 | issue = 1| pages = 128–137 | pmid = 15162323 | pmc = 1181996 | last2 = Kivisild | first2 = Toomas | last3 = Benuzzi | first3 = Giorgia | last4 = Help | first4 = Hela | last5 = Bermisheva | first5 = Marina | last6 = Kutuev | first6 = Ildus | last7 = Barać | first7 = Lovorka | last8 = Peričić | first8 = Marijana | last9 = Balanovsky | first9 = Oleg | last10 = Pshenichnov | first10 = Andrey | last11 = Dion | first11 = Daniel | last12 = Grobei | first12 = Monica | last13 = Zhivotovsky | first13 = Lev A. | last14 = Battaglia | first14 = Vincenza | last15 = Achilli | first15 = Alessandro | last16 = Al-Zahery | first16 = Nadia | last17 = Parik | first17 = Jüri | last18 = King | first18 = Roy | last19 = Cinnioğlu | first19 = Cengiz | last20 = Khusnutdinova | first20 = Elsa | last21 = Rudan | first21 = Pavao | last22 = Balanovska | first22 = Elena | last23 = Scheffrahn | first23 = Wolfgang | last24 = Simonescu | first24 = Maya | last25 = Brehm | first25 = Antonio | last26 = Goncalves | first26 = Rita | last27 = Rosa | first27 = Alexandra | last28 = Moisan | first28 = Jean-Paul | last29 = Chaventre | first29 = Andre | last30 = Ferak | first30 = Vladimir | display-authors = etal }} These estimates are consistent with those of Karafet 2008 cited above. However, Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28,400 ±5,100 years ago, although they calculate the STR variation age of I1 at only 8,100 ±1,500 years ago.P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.

Semino (2000) speculated that the initial dispersion of this population corresponds to the diffusion of the Gravettian culture.{{cite journal |vauthors=Semino O, Passarino G, Oefner PJ|display-authors=etal |title=The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective |journal=Science |volume=290 |issue=5494 |pages=1155–9 |date=November 2000 |pmid=11073453 |doi=10.1126/science.290.5494.1155|bibcode=2000Sci...290.1155S }} Later the haplogroup, along with two cases of Haplogroup C, was found in human remains belonging to the previously mentioned Gravettian culture and in individuals of the Magdalenian and Azilian cultures.{{cite web|title=Palaeolithic DNA from Eurasia|url=http://www.ancestraljourneys.org/palaeolithicdna.shtml|access-date=5 October 2016|archive-url=https://web.archive.org/web/20161003201826/http://www.ancestraljourneys.org/palaeolithicdna.shtml|archive-date=2016-10-03|url-status=dead}} Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I-M170 experienced an independent population expansion immediately after the Last Glacial Maximum.

The five known cases of Haplogroup I from Upper Paleolithic European human remains make it one of the most frequent haplogroup from that period. In 2016, the 31,210–34,580-year-old remains of a hunter-gatherer from Paglicci Cave, Apulia, Italy were found to carry I-M170.{{Cite journal|last1=Fu|first1=Qiaomei|last2=Posth|first2=Cosimo|last3=Hajdinjak|first3=Mateja|last4=Petr|first4=Martin|last5=Mallick|first5=Swapan|last6=Fernandes|first6=Daniel|last7=Furtwängler|first7=Anja|last8=Haak|first8=Wolfgang|last9=Meyer|first9=Matthias|year=2016|title=The genetic history of Ice Age Europe|journal=Nature|language=en|volume=534|issue=7606|pages=200–205|doi=10.1038/nature17993|issn=0028-0836|pmc=4943878|pmid=27135931|bibcode=2016Natur.534..200F|hdl=10211.3/198594}} So far, only Haplogroup F* and Haplogroup C1b have been documented, once each, on older remains in Europe. I2 subclade of I-M170 is the main haplogroup found on male remains in Mesolithic Europe, until circa 6,000 BCE, when mass migration into Europe of Anatolian farmers carrying Y-DNA G2a happened.{{cite web | url=http://www.cam.ac.uk/research/news/ancient-dna-reveals-genetic-continuity-between-stone-age-and-modern-populations-in-east-asia | title=Ancient DNA reveals 'genetic continuity' between Stone Age and modern populations in East Asia| date=February 2017}}

Due to the arrival of so-called Early European Farmers (EEFs), I-M170 is outnumbered by Haplogroup G among Neolithic European remains and by Haplogroup R in later remains.

The earliest documentation of I1 is from Neolithic Hungary, although it must have separated from I2 at an earlier point in time.

In one instance, haplogroup I was found far from Europe, among 2,000-year-old remains from Mongolia.{{cite journal|title=Nuclear and Mitochondrial DNA Analysis of a 2,000-Year-Old Necropolis in the Egyin Gol Valley of Mongolia| doi=10.1086/377005 | pmc=1180365|pmid=12858290|volume=73|issue=2 |date=August 2003|journal=Am. J. Hum. Genet.|pages=247–60 | last1 = Keyser-Tracqui | first1 = C | last2 = Crubézy | first2 = E | last3 = Ludes | first3 = B}}{{dead link|date=January 2017}}

It would seem to be that separate waves of population movement impacted Southeastern Europe. The role of the Balkans as a long-standing corridor to Europe from Anatolia and/or the Caucasus is shown by the common phylogenetic origins of both haplogroups I and J in the parent haplogroup IJ (M429). This common ancestry suggests that the subclades of IJ entered the Balkans from Anatolia or the Caucasus, some time before the Last Glacial Maximum. I and J were subsequently distributed in Asia and Europe in a disjunctive phylogeographic pattern typical of "sibling" haplogroups. A natural geographical corridor like the Balkans is likely to have been used later by members of other subclades of IJ, as well as other haplogroups, including those associated with Early European Farmers.

The existence of Haplogroup IJK – the ancestor of both haplogroups IJ and K (M9) – and its evolutionary distance from other subclades of Haplogroup F (M89), supports the inference that haplogroups IJ and K both arose in Southwestern Asia. Living carriers of F* and IJ* have been reported from the Iranian Plateau.

Distribution

Frequencies of Haplogroup I:

class="wikitable sortable"
style="text-align:center; background:#f0f0f0;"Population% hg I% hg I (Subpopulation)Sampled individualsSource
Abazinians3.488Sergeevich 2007ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ НАРОДОВ ЗАПАДНОГО КАВКАЗА ПО ДАННЫМ О ПОЛИМОРФИЗМЕ Y-ХРОМОСОМЫ, МИТОХОНДРИАЛЬНОЙ ДНК И ALU-ИНСЕРЦИЙ
Abkhazians33.312Nasidze Ivan 2004{{cite journal | url = https://www.familytreedna.com/pdf/caucasus.pdf | author = Nasidze Ivan | year = 2004 | title = Mitochondrial DNA and Y-Chromosome Variation in the Caucasus | journal = Annals of Human Genetics | volume = 68 | issue = Pt 3 | pages = 205–221 | pmid = 15180701 | last2 = Ling | first2 = E. Y. S. | last3 = Quinque | first3 = D. | last4 = Dupanloup | first4 = I. | last5 = Cordaux | first5 = R. | last6 = Rychkov | first6 = S. | last7 = Naumova | first7 = O. | last8 = Zhukova | first8 = O. | last9 = Sarraf-Zadegan | first9 = N. | last10 = Naderi | first10 = G. A. | last11 = Asgary | first11 = S. | last12 = Sardas | first12 = S. | last13 = Farhud | first13 = D. D. | last14 = Sarkisian | first14 = T. | last15 = Asadov | first15 = C. | last16 = Kerimov | first16 = A. | last17 = Stoneking | first17 = M. | doi = 10.1046/j.1529-8817.2004.00092.x | s2cid = 27204150 | access-date = 2016-10-09 | archive-url = https://web.archive.org/web/20170118221617/https://www.familytreedna.com/pdf/caucasus.pdf | archive-date = 2017-01-18 | url-status = dead }}
Adyghe (Adygea)7154Yunusbayev 2011
Adyghe (Cherkessia)2126Sergeevich 2007
Adyghe (Kabardia)1059Nasidze Ivan 2004
Afghanistan3 (Hazara people)60El Sibai 2009{{Cite journal|last1=Haber|first1=Marc|last2=Platt|first2=Daniel E.|last3=Bonab|first3=Maziar Ashrafian|last4=Youhanna|first4=Sonia C.|last5=Soria-Hernanz|first5=David F.|last6=Martínez-Cruz|first6=Begoña|last7=Douaihy|first7=Bouchra|last8=Ghassibe-Sabbagh|first8=Michella|last9=Rafatpanah|first9=Hoshang|year=2012|title=Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events|journal=PLOS One|volume=7|issue=3|pages=e34288|doi=10.1371/journal.pone.0034288|issn=1932-6203|pmc=3314501|pmid=22470552|bibcode=2012PLoSO...734288H|doi-access=free}}
Afghanistan1.5%3.3% (2/60) Hazara, 1.8% (1/56) Tajik204Haber et al. 2012{{cite journal | last1 = Haber | first1 = M | last2 = Platt | first2 = DE | last3 = Ashrafian Bonab | first3 = M | last4 = Youhanna | first4 = SC | last5 = Soria-Hernanz | first5 = DF | display-authors = etal | year = 2012 | title = Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events | journal = PLOS One | volume = 7 | issue = 3| page = e34288 | doi = 10.1371/journal.pone.0034288 | pmid = 22470552 | bibcode = 2012PLoSO...734288H | pmc = 3314501 | doi-access = free }}
Afghanistan0.99%2.6% (2/77) Hazara, 2.1% (3/142) Tajiks, 0/74 Turkmens, 0/87 Pashtuns, 0/127 Uzbeks507Di Cristofaro 2013Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge
Albanians13% (29/223) (Albania)223Sarno 2015
Albanians16 (Tosk), 4 (Gheg)Ferri 2010
Albanians21.82% (12/55) (Tirana)55Battaglia 2008
Albanians7 (Tirana)30Bosch 2006
Algerians0156Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
Andis27
Armenians5FTDNA 2013{{cite web|title=Armenian DNA Project|url=http://f6.s.qip.ru/SeF39xoH.jpg|access-date=2016-10-08|archive-url=https://web.archive.org/web/20161011004807/http://f6.s.qip.ru/SeF39xoH.jpg|archive-date=2016-10-11|url-status=dead}}
Avars2115Balanovsky
Austrians2850 (Vienna), 29 (Graz), 6 (Tyrol){{cite web|url=http://www.jogg.info/41/Wiik.pdf |title=Where did European men come from? |date=2008 |website=jogg.info |access-date=2019-06-07}}
Ashkenazi11099{{Cite web |url=https://sites.google.com/site/levitedna/origins-of-r1a1a-ashkenazi-levites/2014-klyosov-article-on-jewish-dna-genealogy/comments-on-2014-klyosovarticle-on-jewish-dna-genealogy |title=Comments on 2014 Klyosov Article on Jewish DNA Genealogy p. 1 of 2 - Levite DNA |access-date=2016-10-09 |archive-url=https://web.archive.org/web/20161112030803/https://sites.google.com/site/levitedna/origins-of-r1a1a-ashkenazi-levites/2014-klyosov-article-on-jewish-dna-genealogy/comments-on-2014-klyosovarticle-on-jewish-dna-genealogy |archive-date=2016-11-12 |url-status=dead }}
Azeri372Nasidze Ivan 2004
Balkars3135Kutuev 2007Кутуев Ильдус Альбертович. Генетическая структура и молекулярная филогеография народов кавказа
Belarusians2311 (West), 15 (North), 16 (East), 28 (Centre), 30 (East Polesie), 34 (West Polesie)565Kushniarevich 2013
Belarusians32Polesie- 43 (Vichin), 12 (Avtyuki)204Sergeevich 2015ВКЛАД ОТДЕЛЬНЫХ ПОЛЕССКИХ ПОПУЛЯЦИЙ И ПОПУЛЯЦИИ БЕЛОРУССКИХ ТАТАР В ГЕНОФОНД НАСЕЛЕНИЯ БЕЛАРУСИ [https://vk.com/doc-77435148_412378746?dl=f696d82058bb036a05]
Bosnia and Herzegovina5373 (Croats), 49 (Bosniaks), 33 (Serbs)256Marjanovic 2006
Bosnia and Herzegovina65Herzegovina- 71 (Mostar, Siroki Brijeg), Bosnia- 54 (Zenica)210Pericic 2005{{cite journal |vauthors=Pericic M, Lauc LB, Klaric IM, etal |title=High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations |journal=Mol. Biol. Evol. |volume=22 |issue=10 |pages=1964–75 |date=October 2005 |pmid=15944443 |doi=10.1093/molbev/msi185 |doi-access=free }}
Bosnia and Herzegovina73 (Croats), 45 (Bosniaks), 36 (Serbs)255Battaglia 2008{{cite journal|last1=Battaglia|first1=Vincenza|last2=Fornarino|first2=Simona|last3=Al-Zahery|first3=Nadia|last4=Olivieri|first4=Anna|last5=Pala|first5=Maria|last6=Myres|first6=Natalie M|last7=King|first7=Roy J|last8=Rootsi|first8=Siiri|last9=Marjanovic|first9=Damir|last10=Primorac|first10=Dragan|last11=Hadziselimovic|first11=Rifat|last12=Vidovic|first12=Stojko|last13=Drobnic|first13=Katia|last14=Durmishi|first14=Naser|last15=Torroni|first15=Antonio|last16=Santachiara-Benerecetti|first16=A Silvana|last17=Underhill|first17=Peter A|last18=Semino|first18=Ornella|title=Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe|journal=European Journal of Human Genetics|volume=17|pages=820–30|date=24 December 2008 | doi= 10.1038/ejhg.2008.249|pmc=2947100|pmid=19107149|issue=6|url=http://www.draganprimorac.com/wp-content/uploads/2010/05/Battaglia.pdf|display-authors=8}}
Bulgarians27-2940 (Varna), 32 (Sofia), 30 (Plovdiv), 10 (Haskovo)935Karachanak 2009–13{{cite journal |id={{INIST|21359873}} |last1=Karachanak |first1=Sena |last2=Fornarino |first2=Simona |last3=Grugni |first3=Viola |last4=Semino |first4=Ornella |last5=Toncheva |first5=Draga |last6=Galabov |first6=Angel |last7=Atanasov |first7=Boris |year=2009 |title=Y-Chromosomal Haplogroups in Bulgarians |url=http://www.proceedings.bas.bg/cgi-bin/mitko/0DOC_abs.pl?2009_3_16 |journal=Comptes rendus de l'Académie bulgare des Sciences |issn=1310-1331 |volume=62 |issue=3 |pages=393–400}}{{cite journal | vauthors = Karachanak S, Grugni V, Fornarino S, Nesheva D, Al-Zahery N, Battaglia V, Carossa V, Yordanov Y, Torroni A, Galabov AS, Toncheva D, Semino O | title = Y-chromosome diversity in modern Bulgarians: new clues about their ancestry | journal = PLOS One | volume = 8 | issue = 3 | pages = e56779 | year = 2013 | pmid = 23483890 | pmc = 3590186 | doi = 10.1371/journal.pone.0056779 | editor1-last = Pereira | bibcode = 2013PLoSO...856779K | editor1-first = Luisa Maria Sousa Mesquita | doi-access = free }}
Bulgarians34100Begona Martinez-Cruz 2012
Bulgaria19 (Bulgarian Turks)63Zaharova 2002{{cite web | url=https://docs.google.com/spreadsheets/d/1-TYdFLe_4wYW7HrJEQo7lryJM4ag_m4nQ7tTLzzBIlQ/pubhtml | title=Bulgarian_Y_Table.xlsx}}
Central Asia2984Rootsi 2004
Chechens0330Balanovsky
Croats451100Mrsic 2012
Croats4755 (Hvar), 52 (Osijek), 41 (Pula), 57 (Split), 29 (Varaždin)518Primorac 2022{{cite journal|author=D. Primorac|year=2022|title=Croatian genetic heritage: an updated Y-chromosome story|journal=Croatian Medical Journal|volume=63|issue=3|pages=273–286|doi=10.3325/cmj.2022.63.273|pmid=35722696 |pmc=9284021 |ref={{harvid|Primorac et al.|2022}}|display-authors=etal|doi-access=free|url=http://www.cmj.hr/2022/63/3/35722696.htm}}
Cyprus1164El-Sibai 2009Geographical Structure of the Y-chromosomal Genetic

Landscape of the Levant: A coastal-inland contrast

Czechs1825 (Klatovy), 25 (Písek), 15 (Brno) 14 (Hradec Králové), 10 (Třebíč)257Luca 2007Y-chromosomal variation in the Czech Republic
Danes49194Rootsi 2004
Darginians5826Nasidze Ivan 2004
Darginians (Kaitak)0101
Dutch27.82085Altena 2020Altena, E., Smeding, R., van der Gaag, K.J. et al. The Dutch Y-chromosomal landscape. Eur J Hum Genet 28, 287–299 (2020). https://doi.org/10.1038/s41431-019-0496-0
Dutch33410Van Doorn 2008ZONEN VAN ADAM IN NEDERLAND

Genetische genealogie : een zoektocht in ons DNA-archief

Egyptians0124El-Sibai 2009{{Cite journal|last1=El-Sibai|first1=Mirvat|last2=Platt|first2=Daniel E.|last3=Haber|first3=Marc|last4=Xue|first4=Yali|last5=Youhanna|first5=Sonia C.|last6=Wells|first6=R. Spencer|last7=Izaabel|first7=Hassan|last8=Sanyoura|first8=May F.|last9=Harmanani|first9=Haidar|year=2009|title=Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast|journal=Annals of Human Genetics|volume=73|issue=6|pages=568–581|doi=10.1111/j.1469-1809.2009.00538.x|issn=1469-1809|pmc=3312577|pmid=19686289}}
Egyptians1370
Estonians19194Rootsi 2004
English18945Rootsi 2004
English2612 (Cornwall), 38 (Essex)1830FTDNA 2016{{cite web|url=https://s-media-cache-ak0.pinimg.com/originals/d1/09/43/d109434a9e66aad55a8b10c4677dbba3.png |title=Photo |website=s-media-cache-ak0.pinimg.com |format=PNG |access-date=2019-06-07}}
Estonians17118Lappalainen 2008Migration Eaves to the Baltic Region
Flemish Belgians28113{{cite web | url=http://www.jogg.info/32/mertens.htm | title=Y Haplogroup Frequencies in the Flemish Populstion}}
Finland2936 (Swedes from Ostrobothnia), 15 (Northern Savo)536Lappalainen 2006{{cite journal|title = Regional differences among the Finns: A Y-chromosomal perspective|last1 = Lappalainen |first1 = Tuuli|last2 = Koivumäki|first2= Satu|last3 =Salmela|first3=Elina|last4= Huoponen|first4= Kirsi|last5 = Sistonen|first5= Pertti| last6 = Savontaus|first6 = Marja-Liisa|last7 = Lahermo|first7 = Päivi|journal = Gene|volume = 376|issue = 2|date = 19 July 2006|pages = 207–215|doi = 10.1016/j.gene.2006.03.004|pmid = 16644145 }}
French16 (South), 24 (Normandy), 4 (Lyon), 4 (Corsica)Rootsi 2004
French95 (Auvergne), 13 (Brittany), 9 (Nord Pas de Calais)555Ramos-Luis 2009{{cite journal |title = Phylogeography of French male lineages|last1 = Ramos-Luis|first1 =E.|last2= Blanco-Verea | first2= A. |last3 = Brión|first3= M. |last4= Van Huffel|first4= V. |last5 = Carracedo|first5 = A. |last6 = Sánchez-Diz|first6 = P. |journal = Forensic Science International: Genetics Supplement Series|volume = 2|issue = 1|date = December 2009|pages =439–441|doi = 10.1016/j.fsigss.2009.09.026| s2cid=85134429 |doi-access = free}}
French1311 (Paris), 18 (Strasburg), 10 (Lyon)333Kari Hauhio
Gagauzes2889Varzari 2006
Georgians063Rootsi 2004
Georgians477Nasidze Ivan 2004
Germans2432 (Berlin), 32 (Hamburg), 15 (Leipzig)1215Kayser 2005{{Cite journal|last1=Kayser|first1=Manfred|last2=Lao|first2=Oscar|last3=Anslinger|first3=K|last4=Augustin|first4=Christa|last5=Bargel|first5=G.|last6=Edelmann|first6=J|last7=Elias|first7=Sahar|last8=Heinrich|first8=M|last9=Henke|first9=Jürgen|year=2005|title=Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis|url=https://www.researchgate.net/publication/40852497|journal=Human Genetics|volume=117|issue=5|pages=428–443|issn=0340-6717|doi=10.1007/s00439-005-1333-9|pmid=15959808|s2cid=11066186}}
Greeks1430 (Macedonia)261Rootsi 2004
Greeks10 (Athens), 30 (Macedonia)149Battaglia 2008
Greeks36 (Serres), 24 (Agrinio), 20 (Thessaloniki), 18 (Mytilene), 14 (Crete), 14 (Larissa), 11 (Patrai), 12 (Karditsa), 8 (Ioannina), 2 (Chios)366Di Giacommo 2003{{Cite web |url=https://www.familytreedna.com/pdf/italy.pdf |title=Archived copy |access-date=2016-10-08 |archive-url=https://web.archive.org/web/20170120144258/https://www.familytreedna.com/pdf/italy.pdf |archive-date=2017-01-20 |url-status=dead }}{{subscription required}}
Greeks12 (North), 24 (South)142Zalloua 2008
Greenlanders17215Sanchez 2004{{cite journal |title = Y chromosome SNP haplogroups in Danes,Greenlanders and Somalis|last1 = Sanchez|first1 = J.J. |last2= Børsting|first2=C. |last3 = Hernandez|first3 = A. |last4 = Mengel-Jørgensen|first4= J. |last5=Morling|first5= N. |journal = International Congress Series|volume = 1261|date = April 2004 |pages = 347–349|doi = 10.1016/S0531-5131(03)01635-2}}
Hungarians23162Rootsi 2004
Hungarians28230Vago Zalan Andrea 2008
Indians0 (North India)560Presence of three different paternal lineages among North Indians: a study of 560 Y chromosomes (2009)
Ingush0143
Iranians222 (South Iran), 5 (Khorasan), 0 (Teheran)186Di Cristofaro 2013
Iranians1 (West), 1 (East)324Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon
Iranians083Rootsi 2004
Iranians192El-Sibai 2009
Iranians06 (Armenians of Teheran), 0 (Persians of Teheran, Fars, Isfahan, Khorasan, Yazd)952Grugni 2012
Iraqis1176Rootsi 2004{{cite journal | pmc = 1181943 | pmid=15024688 | doi=10.1086/383203 | volume=74 | issue=4 | title=The western and eastern roots of the Saami--the story of genetic "outliers" told by mitochondrial DNA and Y chromosomes | date=April 2004 | journal=Am. J. Hum. Genet. | pages=661–82 | last1 = Tambets | first1 = K | last2 = Rootsi | first2 = S | last3 = Kivisild | first3 = T | display-authors = etal }}
Iraqis1117El-Sibai 2009
Irish1176Rootsi 2004
Irish10119Cappeli 2013A Y Chromosome Census of the British Isles
Irish11 (Rush, County Dublin)Capelli 2003
Italians5 (North), 7 (Central), 9 (South and Sicily), 39 (Sardinia)Rootsi 2004
Italians1031 (Sardinia), 4 (Umbria, Marche)884Boattini 2013Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata
Italians70 (Calabria, Pescara, Garfagnana, Val di Non), 5 (Verona), 7(Genoa), 19 (Foggia)524Di Giacomo 2003Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects
Italians36 (Filettino) 35 (Cappadocia, Abruzzo), 28 (Vallepietra)Messina 2015Traces of forgotten historical events in mountain communities in Central Italy: A genetic insight
Italians23 (Udine), 17 (Saniti), 13 (Picentes), 7 (Latini)583Brisighelli 2012Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage
Italians30 (Stelvio)Genetic Structure in Contemporary South Tyrolean Isolated Populations Revealed by Analysis of Y-Chromosome, mtDNA, and Alu Polymorphisms
Italians31 (Caccamo)Gaetano 2008Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome
Jordanians1273El-Sibai 2009
Jordanians5 (Amman), 0 (Dead Sea)146Flores 2005Isolates in a corridor of migrations: A high-resolution analysis of Y-chromosome variation in Jordan
Kara Nogays1376
Karachays969Sergeevich 2007
Kazakhs1370Вестник Московского университета. Серия XXIII АНТРОПОЛОГИЯ № 1/2014: 96–101СВЯЗЬ ИЗМЕНЧИВОСТИ Y ХРОМОСОМЫ И РОДОВОЙСТРУКТУРЫ: ГЕНОФОНД СТЕПНОЙ АРИСТОКРАТИИИ ДУХОВЕНСТВА КАЗАХОВ
Kosovar Albanians8114Pericic 2005
Kumyks073Kutuev 2007
Kurds4 (West Iran)21Malyarchuk 2013Y chromosomes in Iranians and Tajiks
Kurds2 (Iran)59Gragni 2012
Kurmanji17 (Turkey), 0 (Georgia)112Nasidze 2005MtDNA and Y-chromosome Variation in Kurdish Groups
Kuwaiti042El-Sibai 2009
Kyrgyzstan0 (Uyghurs), 0 (Kyrgyz)Di Cristofaro 2013
Laks14The dual origin of tati-speakers from dagestan as written in the genealogy of uniparental variants
Latvians93 (Southwest)Pliss et al. Y-Chromosomal Lineages of Latvians in the Contextof the Genetic Variation of the Eastern-Baltic Region
Lebanese310 (North Maronite), 0 (Shia)951Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events
Lebanese566Rootsi 2004
Lezgis081
Lithuanians7Kushniarevich 2015
Libyans083
Libyans21175Fendri 2015Paternal lineages in Libya inferred from Y-chromosome haplogroups
Macedonians34 (Skopje)79Pericic 2005
Macedonians2431 (Macedonians), 12 (Albanians)343Noevski 2010
Macedonians13 (Albanians)64Battaglia 2008
Maltese1290El-Sibai 2009
Moldovans29 (Moldovans), 25 (Ukrainians)Varzari 2006
Moroccans0316El-Sibai 2009
Moroccans0760
Mongols1160Di Cristofaro 2013
Norwegians3740 (Oslo) 30 (West), 42 (East, South), 35 (North), 33 (Bergen)Dupuy 2005
Pakistan0638Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan (2006)
Poles1719 (Warsaw), 12 (Lublin), 22 (Szczecin)913Kayser 2005
Poles18191Rootsi 2004
Portuguese5303Rootsi 2004
Portuguese83 (Lisbon), 0 (Setúbal), 18 (Braga)657Beleza 2005Micro-Phylogeographic and Demographic History of Portuguese Male Lineages
Qatar072El-Sibai 2009
Romani17 (Hungary), 10 (Tiszavasvari), 5 (Tokaj) 37 (Taktakoz), 11 (Slovakia)Vago Zalan Andrea 2008
Romanians2836 (Brasov), 18 (Cluj)178Martinez-Cruz 2012{{cite journal | vauthors = Martinez-Cruz B, Ioana M, Calafell F, Arauna LR, Sanz P, Ionescu R, Boengiu S, Kalaydjieva L, Pamjav H, Makukh H, Plantinga T, van der Meer JW, Comas D, Netea MG | title = Y-chromosome analysis in individuals bearing the Basarab name of the first dynasty of Wallachian kings | journal = PLOS One | volume = 7 | issue = 7 | pages = e41803 | year = 2012 | pmid = 22848614 | pmc = 3404992 | doi = 10.1371/journal.pone.0041803 | editor1-last = Kivisild | bibcode = 2012PLoSO...741803M | editor1-first = Toomas | doi-access = free }}
Romanians22361Rootsi 2004
Russians13 (North Europe), 18 (Centre Europe), 21 (South Europe), 27 (Unzha), 0 (Mezen)1228Balanovsky 2008
Russia2 (Udmurts), 5 (Pinega), 5 (Komi), 5 (Tatars), 6 (Bashkortostan), 7 (Chuvashes), 19 (Kostroma), 11 (Smolensk), 17 (Belgorod), 19 (Mordvins), 23 (Cossacks), 24 (Adygea)Rootsi 2004
Saami31Rootsi 2004
Saudis01597Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions.
Scotland1117 (Scottish Isles)Rootsi 2004
Sephardi4 (Portugal)57
Serbs39Serbia with Kosovo209Zgonjanin 209{{cite journal | vauthors = Zgonjanin D, Alghafri R, Antov M, Stojiljković G, Petković S, Vuković R, Drašković D | title = Genetic characterization of 27 Y-STR loci with the Yfiler® Plus kit in the population of Serbia | journal = Forensic Science International. Genetics | volume = 31 | pages = e48–e49 | date = November 2017 | pmid = 28789900 | doi = 10.1016/j.fsigen.2017.07.013}}
Serbs48 (Serbia), 39 (Kosovo), 52 (Herzegovina and Montenegro)1200Mihajlovic 2022{{Cite journal |last1=Mihajlovic |first1=Milica |last2=Tanasic |first2=Vanja |last3=Markovic |first3=Milica Keckarevic |last4=Kecmanovic |first4=Miljana |last5=Keckarevic |first5=Dusan |date=2022-11-01 |title=Distribution of Y-chromosome haplogroups in Serbian population groups originating from historically and geographically significant distinct parts of the Balkan Peninsula |url=https://www.fsigenetics.com/article/S1872-4973(22)00108-9/abstract |journal=Forensic Science International: Genetics |language=English |volume=61 |page=102767 |doi=10.1016/j.fsigen.2022.102767 |issn=1872-4973 |pmid=36037736|s2cid=251658864 |url-access=subscription }}
Slovaks28250Petrejcikova 2013The genetic structure of the Slovak population revealed by Y-chromosome polymorphisms
Slovenians3057 (Spodnjeposavska)458Vakar 2010ANALIZA Y-DNK HAPLOTIPOV SLOVENCEV
Spaniards618 (Asturias), 0 (Gascony)1002Adams 2008Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
Sudanese5 (Nubians), 4 (Gaalien), 7 (Mesereia)Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History
Swedes4232 (Ostergotaland & Jonkoping) 50 (Gotland & Varmland)305Karlsson2006{{Cite journal | doi = 10.1038/sj.ejhg.5201651 | last1 = Karlsson | first1 = Andreas O | last2 = Wallerstrom | first2 = Thomas | last3 = Gotherstrom | first3 = Anders | last4 = Holmlund | first4 = Gunilla | year = 2006 | title = Y-chromosome diversity in Sweden – A long-time perspective | journal = European Journal of Human Genetics | volume = 14 | issue = 8| pages = 963–970 | pmid = 16724001 | doi-access = free }}
Swedes26 (North Sweden),{{cite journal |vauthors=Rootsi S, Magri C, Kivisild T, etal |title=Phylogeography of Y-chromosome haplogroup I-M170 reveals distinct domains of prehistoric gene flow in europe |journal=Am. J. Hum. Genet. |volume=75 |issue=1 |pages=128–37 |date=July 2004 |pmid=15162323 |pmc=1181996 |doi=10.1086/422196 }}Rootsi2004
Swedes41 (South), 26 (North)Rootsi 2004
Swedes4460 (Kristianstad), 60 (Kalmar), 59 (Kronoberg), 55 (Stockholm), 37 (North Norrland), 52 (South Norrland)1800FTDNA 2016{{Cite web |url=http://dna.scangen.se/index.php?show=stats&stat=haplopie&lang=en&haplo_level=3&lan_sel=&database=ftdna |title=Swedish Haplogroup Database (Stats haplopie) |access-date=2016-10-08 |archive-url=https://web.archive.org/web/20161010095358/http://dna.scangen.se/index.php?show=stats&stat=haplopie&lang=en&haplo_level=3&lan_sel=&database=ftdna |archive-date=2016-10-10 |url-status=dead }}
Swiss8144Rootsi 2004
Swiss2313 (Lausanne), 32 (Bern)
Syrians2 (West), 3 (East)520
Syrians2554El Sibai 2009
Tataers33 (China)33Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians (2010)
Tunisians0El-Sibai 2009
Tunisians0601
Turks512 (Marmara), 10 (Istanbul), 7 (Western Anatolia), 4 (Central Anatolia), 0 (Eastern Anatolia)523Cinnioglu 2003
Turks5741Rootsi 2004
UAE0164El-Sibai 2009
Ukrainians22585Rootsi 2004
Ukrainians2833 (Sumy), 23 (Ivano-Frankivsk)701Kushniarevich 2013
Welsh8196Rootsi 2004
Yemenese062El-Sibai 2009
Zazas33 (Turkey)27Nasidze 2005
17 (Albanians in Tirana), 29 (Macedonians in Skopje), 21 (Aromanians in Krusevo), 19 (Greeks in Thrace), 42 (Aromanians in Andon Poci), 42 (Romanians in Constanta), 39 (Romanians in Piteşti)Bosch 2006{{Cite journal | doi = 10.1111/j.1469-1809.2005.00251.x | last1 = Bosch | first1 = E. | last2 = Calafell | first2 = F. | last3 = Gonzalez-Neira | first3 = A. | last4 = Flaiz | year = 2006 | first4 = C | last5 = Mateu | first5 = E | last6 = Scheil | first6 = HG | last7 = Huckenbeck | first7 = W | last8 = Efremovska | first8 = L | last9 = Mikerezi | first9 = I | last10 = Xirotiris | first10 = N. | last11 = Grasa | first11 = C. | last12 = Schmidt | first12 = H. | last13 = Comas | first13 = D. | title = Paternal and maternal lineages in the Balkans show a homogeneous landscape over linguistic barriers, except for the isolated Aromuns | journal = Annals of Human Genetics | volume = 70 | issue = Pt 4| pages = 459–87 | pmid = 16759179 | s2cid = 23156886 | display-authors = 8 }}
47 (Romanians from Buhusi and Piatra Neamț), 35 (Moldovans from Sofia), 24 (Moldovans from Karasahani) 24 (Gagauzes from Etulia), 31 (Gagauzes from Kongaz), 25 (Ukrainians from Rashkovo)Vazari 2006
38 (Sweden), 41 (Western Finland), 28 (Eastern Finland), 18 (Karelia), 12 (Lithuania), 7 (Latvia), 17 (Estonia)Lappalainen2008{{cite journal | pmid = 18294359 | doi=10.1111/j.1469-1809.2007.00429.x | volume=72 | issue=Pt 3 | title=Migration waves to the Baltic Sea region |date=May 2008 | journal=Ann. Hum. Genet. | pages=337–48| last1=Lappalainen | first1=T. | last2=Laitinen | first2=V. | last3=Salmela | first3=E. | last4=Andersen | first4=P. | last5=Huoponen | first5=K. | last6=Savontaus | first6=M.-L. | last7=Lahermo | first7=P. | s2cid=32079904 | doi-access=free }}
34 (Iranians from Teheran), 10 (Iranians from Isfahan), 32 (Ossetians from Ardon), 13 (Ossetians from Digora)Nasidze Ivan. 2004
3 (Tajiks) 3 (East Persians)Malyarchuk 2013
2 (Kizhi), 4 (Teleuts), 4 (Khakassians), 3 (Todjins), 2 (Evenks) 3 (Tofalars), 1 (Tuvinians)

Subgroups

The subclades of Haplogroup I-M170 with their defining mutations, as of 2011.[http://www.isogg.org/tree/ISOGG_HapgrpI.html ISOGG 2011] Up-to-date phylogenetic trees listing all currently known subclades of I can be found at [https://www.yfull.com/tree/I2/ Y-Full] and [https://www.familytreedna.com/public/y-dna-haplotree/I FamilyTreeDNA]

  • I-M170 ( L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, Page123, U179) Middle East, Caucasus, Europe.
  • I-M253 Haplogroup I1 (L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157, L186, L187, M253, M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe In Anatolia at 1%{{Cite journal|last1=Cinnioğlu|first1=Cengiz|last2=King|first2=Roy|last3=Kivisild|first3=Toomas|last4=Kalfoğlu|first4=Ersi|last5=Atasoy|first5=Sevil|last6=Cavalleri|first6=Gianpiero L.|last7=Lillie|first7=Anita S.|last8=Roseman|first8=Charles C.|last9=Lin|first9=Alice A.|title=Excavating Y-chromosome haplotype strata in Anatolia|journal=Human Genetics|language=en|volume=114|issue=2|pages=127–148|doi=10.1007/s00439-003-1031-4|issn=0340-6717|pmid=14586639|date=January 2004|s2cid=10763736}}
  • I1a DF29/S438
  • I1a1 CTS6364/Z2336
  • I1a1a M227
  • I1a1a1 M72
  • I1a1b L22/S142
  • I1a1b1 P109
  • I1a1b2 L205
  • I1a1b3 L287
  • I1a1b3a L258/S335
  • I1a1b3a1 L296
  • I1a1b4 L300/S241
  • I1a1b5 L813/Z719
  • I1a2 S244/Z58
  • I1a2a S246/Z59
  • I1a2a1 S337/Z60, S439/Z61, Z62
  • I1a2a1a Z140, Z141
  • I1a2a1a1 Z2535
  • I1a2a1a1a L338
  • I1a2a1a2 F2642
  • I1a2a1b Z73
  • I1a2a1c L573
  • I1a2a1d L1248
  • I1a2a1d1 L803
  • I1a2a2 Z382
  • I1a2b S296/Z138, Z139
  • I1a2b1 Z2541
  • I1a3 S243/Z63
  • I1a3a L1237
  • I1b Z131{{cite web|url=http://isogg.org/tree/ISOGG_HapgrpI.html|title=ISOGG 2017 Y-DNA Haplogroup I|website=isogg.org}}
  • I-M438 Haplogroup I2 L68/PF3781/S329, M438/P215/PF3853/S31
  • I2a L460/PF3647/S238
  • I2a1 P37.2
  • I2a1a L158/PF4073/S433, L159.1/S169.1, M26/PF4056
  • I2a1a1 L160/PF4013
  • I2a1b L178/S328, M423
  • I2a1b1 L161.1/S185
  • I2a1b2 L621/S392
  • I2a1b2a1a L147.2
  • I2a1c L233/S183
  • I2a2 L35/PF3862/S150, L37/PF6900/S153, L181, M436/P214/PF3856/S33, P216/PF3855/S30, P217/PF3854/S23, P218/S32
  • I2a2a L34/PF3857/S151, L36/S152, L59, L368, L622, M223, P219/PF3859/S24, P220/S119, P221/PF3858/S120, P222/PF3861/U250/S118, P223/PF3860/S117, Z77
  • I2a2a1 CTS616, CTS9183
  • I2a2a1a M284
  • I2a2a1a1 L1195
  • I2a2a1a1a L126/S165, L137/S166, L369
  • I2a2a1a1b L1193
  • I2a2a1b L701, L702
  • I2a2a1b1 P78
  • I2a2a1b2 L699, L703
  • I2a2a1b2a L704
  • I2a2a1c Z161
  • I2a2a1c1 L801/S390
  • I2a2a1c1a CTS1977
  • I2a2a1c1a1 P95
  • I2a2a1c1b CTS6433
  • I2a2a1c1b1 Z78
  • I2a2a1c1b1a L1198
  • I2a2a1c1b1a1 Z190
  • I2a2a1c1b1a1a S434/Z79
  • I2a2a1c2 L623, L147.4
  • I2a2a1d L1229
  • I2a2a1d1 Z2054
  • I2a2a1d1a L812/S391
  • I2a2a1d2 L1230
  • I2a2a2 L1228
  • I2a2b L38/S154, L39/S155, L40/S156, L65.1/S159.1, L272.3
  • I2a2b1 L533
  • I2b L415, L416, L417
  • I2c L596/PF6907/S292, L597/S333

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer.

=I-M170=

The composite subclade I-M170 contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several I* individuals, who do not fall into any known subclades, have been found among the Lak people of Dagestan, at a rate of (3/21), as well as Turkey (8/741), Adygea in the Caucasus (2/138) and Iraq (1/176), even though I-M170 occurs at only very low frequencies among modern populations of these regions as a whole. This is consistent with the belief that the haplogroup first appeared in South West Eurasia.

There are also high frequencies of Haplogroup I* among the Andalusians (3/103), French (4/179), Slovenians (2/55), Tabassarans (1/30),{{Cite journal|last1=Caciagli|first1=Laura|last2=Bulayeva|first2=Kazima|last3=Bulayev|first3=Oleg|last4=Bertoncini|first4=Stefania|last5=Taglioli|first5=Luca|last6=Pagani|first6=Luca|last7=Paoli|first7=Giorgio|last8=Tofanelli|first8=Sergio|year=2009|title=The key role of patrilineal inheritance in shaping the genetic variation of Dagestan highlanders|journal=Journal of Human Genetics|language=en|volume=54|issue=12|pages=689–694|doi=10.1038/jhg.2009.94|pmid=19911015|issn=1434-5161|doi-access=free|hdl=11577/3233090|hdl-access=free}} and Saami (1/35).{{Cite journal|last1=Rootsi|first1=Siiri|last2=Magri|first2=Chiara|last3=Kivisild|first3=Toomas|last4=Benuzzi|first4=Giorgia|last5=Help|first5=Hela|last6=Bermisheva|first6=Marina|last7=Kutuev|first7=Ildus|last8=Barać|first8=Lovorka|last9=Peričić|first9=Marijana|year=2004|title=Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe|journal=American Journal of Human Genetics|volume=75|issue=1|pages=128–137|doi=10.1086/422196|issn=0002-9297|pmc=1181996|pmid=15162323}}

(Neither study from which the above figures were drawn excluded the present I2-M438 clade as a whole, but only certain subclades, so these presumed cases I* may possibly belong to I2.)

A living Hazara male from Afghanistan has also been found to carry I*, with all known subclades of both I1 (M253) and I2 (M438) ruled out.{{cite journal |vauthors=Cristofaro J, etal |title=Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge |journal=PLOS One |date=October 2013 | doi=10.1371/journal.pone.0076748 |volume=8 |issue=10 |pages=e76748 |pmid=24204668 |pmc=3799995|bibcode=2013PLoSO...876748D |doi-access=free }}

=I1-M253=

{{Main|Haplogroup I-M253}}

Haplogroup I1-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%. I1 is believed to have become common as a result of a founder effect during the Nordic Bronze Age, and subsequently spread throughout Europe during the Migration Period when Germanic tribes migrated from southern Scandinavia and northern Germany to other places in Europe.{{Cite journal|last1=Allentoft|first1=Morten E.|last2=Sikora|first2=Martin|last3=Sjögren|first3=Karl-Göran|last4=Rasmussen|first4=Simon|last5=Rasmussen|first5=Morten|last6=Stenderup|first6=Jesper|last7=Damgaard|first7=Peter B.|last8=Schroeder|first8=Hannes|last9=Ahlström|first9=Torbjörn|last10=Vinner|first10=Lasse|last11=Malaspinas|first11=Anna-Sapfo|date=June 2015|title=Population genomics of Bronze Age Eurasia|url=https://www.nature.com/articles/nature14507|journal=Nature|language=en|volume=522|issue=7555|pages=167–172|doi=10.1038/nature14507|pmid=26062507|bibcode=2015Natur.522..167A|s2cid=4399103|issn=1476-4687}}

Outside Fennoscandia, distribution of Haplogroup I1-M253 is closely correlated with that of Haplogroup I2a2-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I-M170 Y-chromosomes are I1-M253. Another characteristic of the Scandinavian I1-M253 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I1-M253 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I1-M253 among the modern French and Italian populations. This, along with the structure of the phylogenetic tree of I1-M253 strongly suggests that most living I1 males are the descendants of an initially small group of reproductively successful men who lived in Scandinavia during the Nordic Bronze Age.{{Cite journal|date=2009-11-03|title=Ancient DNA Reveals Lack of Continuity between Neolithic Hunter-Gatherers and Contemporary Scandinavians|journal=Current Biology|language=en|volume=19|issue=20|pages=1758–1762|doi=10.1016/j.cub.2009.09.017|issn=0960-9822|doi-access=free|last1=Malmström|first1=Helena|last2=Gilbert|first2=M. Thomas P.|last3=Thomas|first3=Mark G.|last4=Brandström|first4=Mikael|last5=Storå|first5=Jan|last6=Molnar|first6=Petra|last7=Andersen|first7=Pernille K.|last8=Bendixen|first8=Christian|last9=Holmlund|first9=Gunilla|last10=Götherström|first10=Anders|last11=Willerslev|first11=Eske|pmid=19781941}}{{Cite journal|last1=Karlsson|first1=Andreas O.|last2=Wallerström|first2=Thomas|last3=Götherström|first3=Anders|last4=Holmlund|first4=Gunilla|date=August 2006|title=Y-chromosome diversity in Sweden – A long-time perspective|journal=European Journal of Human Genetics|language=en|volume=14|issue=8|pages=963–970|doi=10.1038/sj.ejhg.5201651|pmid=16724001|issn=1476-5438|doi-access=free}}

=I2-M438=

{{Main|Haplogroup I-M438}}

Haplogroup I2-M438, previously I1b, may have originated in southern Europe – it is now found at its highest frequencies in the western Balkans and Sardinia – some 15,000–17,000 years ago and developed into three main subgroups : I2-M438*, I2a-L460, I2b-L415 and I2c-L596.

==I2a1a-M26==

Haplogroup I2a1a-M26 is notable for its strong presence in Sardinia. Haplogroup I-M170 comprises approximately 40% of all patrilines among the Sardinians, and I2a1a-M26 is the predominant type of I among them.

Haplogroup I2a1a-M26 is practically absent east of France and Italy,{{cite web|last=Rootsi|title=Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe figure 1|url=http://hpgl.stanford.edu/publications/AJHG_2004_v75_Semino.pdf|display-authors=etal|url-status=dead|archive-url=https://web.archive.org/web/20070303065549/http://hpgl.stanford.edu/publications/AJHG_2004_v75_Semino.pdf|archive-date=2007-03-03}} while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile-León, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Haplogroup I2a1a-M26 appears to be the only subclade of Haplogroup I-M170 found among the Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile-León in Spain and Béarn in France than among the population of ethnic Basques.{{citation needed|date=November 2011}} The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.

The distribution of I2a1a-M26 also mirrors that of the Atlantic Bronze Age cultures, which indicates a potential spread via the obsidian trade or a regular maritime exchange of some of metallurgical products.

==I2a1b-M423==

File:The approximate frequency and variance of haplogroup I-P37 clusters in Eastern Europe.jpg

Haplogroup I2a1b-M423 is the most frequent Y-chromosome haplogroup I-M170 in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia (50–60%) and Bosnia-Herzegovina (up to 71%,{{cite journal |vauthors=Marjanovic D, Fornarino S, Montagna S, etal |title=The peopling of modern Bosnia-Herzegovina: Y-chromosome haplogroups in the three main ethnic groups |journal=Ann. Hum. Genet. |volume=69 |issue=Pt 6 |pages=757–63 |date=November 2005 |pmid=16266413 |doi=10.1111/j.1529-8817.2005.00190.x |s2cid=36632274 |url=http://www3.interscience.wiley.com/resolve/openurl?genre=article&sid=nlm:pubmed&issn=0003-4800&date=2005&volume=69&issue=Pt%206&spage=757|url-access=subscription }}{{dead link|date=February 2019|bot=medic}}{{cbignore|bot=medic}} avg. 40-50%). Its subclade I-L161 has greater variance in Ireland and Great Britain, but overall frequency is very low (2–3%), while subclade I-L162 has the highest variance and also high concentration in Eastern Europe (Ukraine, Southeastern Poland, Belarus).{{cite thesis |type=PhD |author=O.M. Utevska |date=2017 |title=Генофонд українців за різними системами генетичних маркерів: походження і місце на європейському генетичному просторі |trans-title=The gene pool of Ukrainians revealed by different systems of genetic markers: the origin and statement in Europe |publisher=National Research Center for Radiation Medicine of National Academy of Sciences of Ukraine|url=http://nrcrm.gov.ua/science/councils/dissertation/|language=uk|pages=219–226, 302}}

==I2a2-M436==

The distribution of Haplogroup I2a2-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1-M253; the lack of correlation between the distributions of I1-M253 and I2a2-M436 in Fennoscandia may be a result of Haplogroup I2a2-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I2a2-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I2a2-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I2a2-M436, namely I2a2a1a1-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1-M253 and Haplogroup I2a2-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples. The punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey may be related to the Varangian Guard or rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.{{cite book|last=McEvoy and Bradley|first=Brian P and Daniel G|title=Celtic from the West Chapter 5: Irish Genetics and Celts|year=2010|publisher=Oxbow Books, Oxford, UK|isbn=978-1-84217-410-4|page=117}}

Haplogroup I2a2-M436 also occurs among approximately 1% of Sardinians, and in Hazaras from Afghanistan at 3%.{{cite journal | pmid= 22470552 | doi=10.1371/journal.pone.0034288 | pmc=3314501 | volume=7 | issue=3 | title=Afghanistan's ethnic groups share a Y-chromosomal heritage structured by historical events | year=2012 | journal=PLOS One | pages=e34288| last1=Haber | first1=Marc | last2=Platt | first2=Daniel E. | last3=Ashrafian Bonab | first3=Maziar | last4=Youhanna | first4=Sonia C. | last5=Soria-Hernanz | first5=David F. | last6=Martínez-Cruz | first6=Begoña | last7=Douaihy | first7=Bouchra | last8=Ghassibe-Sabbagh | first8=Michella | last9=Rafatpanah | first9=Hoshang | last10=Ghanbari | first10=Mohsen | last11=Whale | first11=John | last12=Balanovsky | first12=Oleg | last13=Wells | first13=R. Spencer | last14=Comas | first14=David | last15=Tyler-Smith | first15=Chris | last16=Zalloua | first16=Pierre A. | bibcode=2012PLoSO...734288H | doi-access=free }}

Specifications of mutation

The technical details of U179 are:

:Nucleotide change (rs2319818): G to A

:Position (base pair): 275

:Total size (base pairs): 220

:Forward 5′→ 3′: {{DNA sequence|aaggggatatgacgactgatt}}

:Reverse 5′→ 3′: {{DNA sequence|cagctcctcttttcaactctca}}

Height

Although height as a quantitative autosomal trait is not genetically related to Y-DNA haplogroups, it may be associated with unusually tall males, since those in the Dinaric Alps have been reported to be the tallest in the world, with an average male height of the range {{convert|180|cm|ftin|abbr=on}}–{{convert|182|cm|ftin|abbr=on}} in the cantons of Bosnia, {{convert|184|cm|ftin|abbr=on}} in Sarajevo, {{convert|182|cm|ftin|abbr=on}}–{{convert|186|cm|ftin|abbr=on}} in the cantons of Herzegovina mostly populated by Croats.{{cite journal|title=The mountains of giants: An anthropometric survey of male youths in Bosnia and Herzegovina|journal=Royal Society Open Science|volume=4|issue=4|page=161054|language=en|doi=10.1098/rsos.161054|pmid=28484621|pmc=5414258|year=2017|last1=Grasgruber|first1=Pavel|last2=Popović|first2=Stevo|last3=Bokuvka|first3=Dominik|last4=Davidović|first4=Ivan|last5=Hřebíčková|first5=Sylva|last6=Ingrová|first6=Pavlína|last7=Potpara|first7=Predrag|last8=Prce|first8=Stipan|last9=Stračárová|first9=Nikola|bibcode=2017RSOS....461054G}} A 2014 study examining the correlation between Y-DNA haplogroups and height found a correlation between the haplogroups I1, R1b-U106, I2a1b-M423 and tall males.{{Cite journal|date=2014-12-01|title=The role of nutrition and genetics as key determinants of the positive height trend|journal=Economics & Human Biology|language=en|volume=15|pages=81–100|doi=10.1016/j.ehb.2014.07.002|issn=1570-677X|doi-access=free|last1=Grasgruber|first1=P.|last2=Cacek|first2=J.|last3=Kalina|first3=T.|last4=Sebera|first4=M.|pmid=25190282}}

See also

Notes

{{refbegin}}

  • {{cite journal |vauthors=Barać L, Pericić M, Klarić IM, etal |title=Y chromosomal heritage of Croatian population and its island isolates |journal=Eur. J. Hum. Genet. |volume=11 |issue=7 |pages=535–42 |date=July 2003 |pmid=12825075 |doi=10.1038/sj.ejhg.5200992 |s2cid=15822710 |url=http://evolutsioon.ut.ee/publications/Barac2003.pdf |doi-access=free |access-date=2005-12-08 |archive-date=2012-12-17 |archive-url=https://web.archive.org/web/20121217135007/http://evolutsioon.ut.ee/publications/Barac2003.pdf |url-status=dead }}
  • Bennett, E.A., Prat, S., Péan, S., Crépin, L., Yanevich, A., Puaud, S., ... & Geigl, E. M. (2019). [https://www.biorxiv.org/content/biorxiv/early/2019/07/02/685404.full.pdf The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European]. BioRxiv, 685404.
  • {{cite journal |vauthors=Rootsi, S, Kivisild, T, Benuzzi, G, Help, H, etal |title=Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in Europe |journal=Am. J. Hum. Genet.

|volume=75 |issue=1 |pages=128–137 |date=2019 |pmid=12825075 |doi=10.1086/422196|s2cid=2834639|doi-access=free |hdl=10400.13/3045 |hdl-access=free }}

  • The Genographic Project, National Geographic, [https://web.archive.org/web/20050413121925/http://www5.nationalgeographic.com/genographic/atlas.html Atlas of the Human Journey]
  • ISOGG, [http://www.isogg.org/tree//ISOGG_HapgrpI.html Y-DNA Haplogroup I and its Subclades]

{{refend}}

References

{{reflist}}

External links

{{Commons category|Haplogroup I of Y-DNA}}

=Phylogenetic tree and distribution maps=

  • [http://isogg.org/tree/ISOGG_HapgrpI.html Y-DNA Haplogroup I-M170 and Its Subclades] from the International Society of Genetic Genealogy (ISOGG)of 2013
  • [https://web.archive.org/web/20070303065549/http://hpgl.stanford.edu/publications/AJHG_2004_v75_Semino.pdf Phylogeography of Y-Chromosome Haplogroup I]
  • [https://web.archive.org/web/20081216062611/http://www.genebase.com/tutorial/item.php?tuId=12 Frequency Distributions of Y-DNA Haplogroup I and its subclades – with Video Tutorial]
  • [https://web.archive.org/web/20070118213606/http://mbe.oxfordjournals.org/cgi/content/full/22/10/1964/FIG3 Frequency and Variance of I1b] (now considered I2a2-M26)
  • [https://archive.today/20130421171553/http://img99.imageshack.us/img99/3518/i1alargergns0.jpg Map of 'I1a'] (now considered I-M253)
  • [http://www.relativegenetics.com/genomics/images/haploMaps/originals/I1b_large_RG.jpg Map of 'I1b'] {{Webarchive|url=https://web.archive.org/web/20150501154230/http://www.relativegenetics.com/genomics/images/haploMaps/originals/I1b_large_RG.jpg |date=2015-05-01 }} (now considered I2a-P37.2)
  • [http://www.relativegenetics.com/genomics/images/haploMaps/originals/I1c_large_RG.jpg Map of 'I1c'] {{Webarchive|url=https://web.archive.org/web/20080816111741/http://www.relativegenetics.com/genomics/images/haploMaps/originals/I1c_large_RG.jpg |date=2008-08-16 }} (now considered I2b-M223)
  • [http://arslanmb.org/ArmenianDNAProject/WarpedFounderTree-14.pdf Rescalled Haplogroup I Tree (K. Nordtvedt 2011).]

=Projects=

  • [http://www.familytreedna.com/public/HaplogroupIYDNA/default.aspx I Project at FTDNA]
  • [http://www.familytreedna.com/public/yDNA_I1 I1 Project at FTDNA]
  • [http://www.familytreedna.com/public/I2nosubcladeM170P215/default.aspx I2* Project at FTDNA]
  • [http://www.familytreedna.com/public/I2aHapGroup/ I2a project at FTDNA]
  • [https://web.archive.org/web/20070228190531/http://www.familytreedna.com/public/I1c-Y-Clan/ I2b project at FTDNA]
  • [http://www.familytreedna.com/public/I2b2/default.aspx I2b2 L38+ project at FTDNA]
  • [http://www.familytreedna.com/public/scandinavianydna The Scandinavian yDNA Genealogical Project at FTDNA]
  • [http://www.familytreedna.com/public/finland The Finland Genealogical Project at FTDNA]

=Other=

  • [https://web.archive.org/web/20070210071842/http://knordtvedt.home.bresnan.net/ Study of Y-Haplogroup I and Modal Haplotypes]
  • [https://web.archive.org/web/20170116195823/http://ycc.biosci.arizona.edu/ The Y Chromosome Consortium (YCC)]
  • [http://users.skynet.be/lancaster/459=10-10.htm Example haplotypes from I1* "y cluster"]
  • [https://web.archive.org/web/20040901184243/http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/hg/YCC_I.html YCC Haplogroup I page – I1a (now considered I-M253), I1b (now considered I-P37.2) and I1c (now considered I-M223)]
  • [http://members.bex.net/jtcullen515/haplotest.htm Haplo-I Subclade Predictor] {{Webarchive|url=https://web.archive.org/web/20220402123728/http://members.bex.net/jtcullen515/haplotest.htm |date=2022-04-02 }}
  • [https://web.archive.org/web/20060320202940/https://www3.nationalgeographic.com/genographic/atlas.html?card=my036 Spread of Haplogroup I], from National Geographic
  • I2b2 Y-DNA found in Bronze Age skeletons of Lichtenstein Cave
  • [http://sites.google.com/site/haplogroupil38/ Haplogroup I-L38 (I2b2) In Search of the Origin of I-L38 (aka I2b2)]

{{Y-DNA}}

{{DEFAULTSORT:Haplogroup I (Y-Dna)}}

I